PortEco logo

asnB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

asnB

Mnemonic

Asparagine

Synonyms

ECK0662, b0674, JW0660[1], JW0660

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

15.02 minutes 

MG1655: 698400..696736


REL606

NC_012967: 681272..679608


BW2952

NC_012759: 599496..601160


W3110

 

W3110: 699599..697935


DH10B

DH10B: 750992..749328


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

696739

Edman degradation

PMID:7907328[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔasnB (Keio:JW0660)

deletion

deletion

Auxotrophies

PMID:16738554[3]

Shigen

CGSC8751[4]

asnB3057::Tn10

Insertion at 698,404 bp in MG1655 (NC_000913)

Auxotrophies

adapted from Nichols et al.[5]

CAG18433 = CGSC7349[4]

Synonyms: zbf-3057::Tn10 nnnThe Tn10 in CAG18433 is inserted in the asnB regulatory region, 4 bp before the start of the asnB ORF.

asnB50::Tn5

Auxotrophies

CGSC:6797

asnB32

Auxotrophies

shows a leaky Asn- phenotype at 41C

PMID:6102983[6]

CGSC:6804

asnB507::Tn10

Auxotrophies

CGSC:9699

asnB3057::Tn10

Auxotrophies

PMID:2540407[7] PMID:9829956[8]

CGSC:39392

asnB3106::Tn10kan

Auxotrophies

PMID:2540407[7] PMID:9829956[8]

CGSC:39395

ΔasnB723::kan

deletion

deletion

Auxotrophies

PMID:16738554[3]

CGSC:100106


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0660

Plasmid clone

Shigen

PMID:16769691[9]

Status:Clone OK

Primer 1:GCCTGTTCAATTTTTGGCGTATT

Primer 2:CCCTTATACGCCGACTGGTGAAC

16A8

Kohara Phage

Genobase

PMID:3038334[10]

crcA280::Tn10

Linked marker

CAG12077 = CGSC7347[4]

est. P1 cotransduction: 16% [5]
Synonyms:zbe-280::Tn10

nadA57::Tn10

Linked marker

CAG12147 = CGSC7351[4]

est. P1 cotransduction: % [5]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10092

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10092

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000088

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945281

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0090

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0002292

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Boehlein, SK et al. (1994) Glutamine-dependent nitrogen transfer in Escherichia coli asparagine synthetase B. Searching for the catalytic triad. J. Biol. Chem. 269 7450-7 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 5.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  6. Felton, J et al. (1980) Mutations in two unlinked genes are required to produce asparagine auxotrophy in Escherichia coli. J. Bacteriol. 142 221-8 PubMed EcoliWiki page
  7. 7.0 7.1 Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed EcoliWiki page
  8. 8.0 8.1 Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed EcoliWiki page
  9. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  10. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories