PortEco logo

asnS:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

asnS

Mnemonic

Asparagine

Synonyms

ECK0921, b0930, JW0913, lcs, tss[1], tss

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

21.27 minutes 

MG1655: 988208..986808


REL606

NC_012967: 1006076..1004676


BW2952

NC_012759: 889776..891176


W3110

 

W3110: 989407..988007


DH10B

DH10B: 1042136..1040736


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

986811

Edman degradation

PMID:2693216[2]
PMID:9298646[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

asnSP231L

P231L

Auxotrophies

(in temperature-sensitive mutant HO202)

Strain variation; seeded from UniProt:P0A8M0

asnSY426F

Y426F

Auxotrophies

No effect

seeded from UniProt:P0A8M0

asnSY426S

Y426S

Auxotrophies

15-fold increase in Km for ATP

seeded from UniProt:P0A8M0

asnS40(ts)

Auxotrophies

temperature sensitive

CGSC:7220


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0913

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCAGCGTTGTGCCTGTAGCCGA

Primer 2:CCGAAGCTGGCGTTACGCGGAGT

E1D1

Kohara Phage

Genobase

PMID:3038334[5]

11F5

Kohara Phage

Genobase

PMID:3038334[5]

7F5

Kohara Phage

Genobase

PMID:3038334[5]

zca-1230::Tn10

Linked marker

CAG18478 = CGSC7356[6]

est. P1 cotransduction: 18% [7]
Synonyms:zbj-1230::Tn10

zcb-3059::Tn10

Linked marker

CAG12094 = CGSC7358[6]

est. P1 cotransduction: 58% [7]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10094

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10094

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000090

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945555

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0092

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0003162

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Anselme, J & Härtlein, M (1989) Asparaginyl-tRNA synthetase from Escherichia coli has significant sequence homologies with yeast aspartyl-tRNA synthetase. Gene 84 481-5 PubMed EcoliWiki page
  3. Link, AJ et al. (1997) Comparing the predicted and observed properties of proteins encoded in the genome of Escherichia coli K-12. Electrophoresis 18 1259-313 PubMed EcoliWiki page
  4. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  6. 6.0 6.1 CGSC: The Coli Genetics Stock Center
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories