PortEco logo

aspA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

aspA

Mnemonic

Aspartate

Synonyms

ECK4133, b4139, JW4099[1], JW4099

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

94.08 minutes, 94.08 minutes 

MG1655: 4366350..4364914


REL606

NC_012967: 4347048..4345612


BW2952

NC_012759: 4303649..4305085


W3110

 

W3110: 4373007..4371571


DH10B

DH10B: 4466712..4465276


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

4364917

Edman degradation

PMID:2987841[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

aspAK327R

K327R

Auxotrophies

Reduces activity by 99.7%. Increases KM for aspartic acid 5-fold

seeded from UniProt:P0AC38

aspAR29A

R29A

Auxotrophies

No effect on Kcat. Increases KM for aspartic acid 40-fold

seeded from UniProt:P0AC38

aspAK55R

K55R

Auxotrophies

Loss of activity

seeded from UniProt:P0AC38

aspAH124L

H124L

Auxotrophies

Reduces activity by 30%

seeded from UniProt:P0AC38

aspAS143G

S143G

Auxotrophies

Reduces Kcat by 90%. Increases KM for aspartic acid 4-fold

seeded from UniProt:P0AC38

aspAS143T

S143T

Auxotrophies

Reduces Kcat by 98.5%. Increases KM for aspartic acid 2-fold

seeded from UniProt:P0AC38

aspAD10A

D10A

Auxotrophies

Loss of activity

seeded from UniProt:P0AC38

aspAD10N

D10N

Auxotrophies

Reduces Kcal by 80%. Increases KM for aspartic acid 3-fold

seeded from UniProt:P0AC38

aspAR15A

R15A

Auxotrophies

No effect on Kcat. Increases KM for aspartic acid 2.5-fold

seeded from UniProt:P0AC38

aspAH26N

H26N

Auxotrophies

No effect on Kcat. Increases KM for aspartic acid 3-fold

seeded from UniProt:P0AC38

ΔaspA (Keio:JW4099)

deletion

deletion

Auxotrophies

PMID:16738554[3]

Shigen

CGSC8324[4]

aspA22

Auxotrophies

CGSC:5112

aspA23

Auxotrophies

CGSC:5113

ΔaspA765::kan

deletion

deletion

Auxotrophies

PMID:16738554[3]

CGSC:100110


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW4099

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCTCAAACAACATTCGTATCGA

Primer 2:CCtTGTTCGCTTTCATCAGTATA

5G7

Kohara Phage

Genobase

PMID:3038334[6]

9B1

Kohara Phage

Genobase

PMID:3038334[6]

cadB2231::Tn10

Linked marker

CAG18488 = CGSC7479[4]

est. P1 cotransduction: 76% [7]
Synonyms:zjd-2231::Tn10

cycA30::Tn10

Linked marker

CAG12073 = CGSC7482[4]

est. P1 cotransduction: 4% [7]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10095

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10095

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000091

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948658

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0093

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013551

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Takagi, JS et al. (1985) Cloning and nucleotide sequence of the aspartase gene of Escherichia coli W. Nucleic Acids Res. 13 2063-74 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. 6.0 6.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories