Try the new EcoliHub and let us know what you'd like to see.
atpF:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
atpF |
|---|---|
| Gene Synonym(s) |
ECK3729, b3736, JW3714, papF, uncF, unc[1] |
| Product Desc. |
ATP synthase, F0 complex, b subunit[2][3]; Component of b subunit complex[2][3]; ATP synthase, F0 complex[2][3]; ATP synthase[2][3] ATP synthase subunit b, membrane-bound, F0 sector[4] |
| Product Synonyms(s) |
F0 sector of membrane-bound ATP synthase, subunit b[1], B3736[2][1], Unc[2][1], UncF[2][1], PapF[2][1], AtpF[2][1], B chain[2][1] |
| Function from GO |
Cellular Component
Biological Process Molecular Function |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): atpBEFHAGDC[2], atpIBEFHAGDC[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
atpF |
|---|---|
| Mnemonic |
ATP |
| Synonyms |
ECK3729, b3736, JW3714, papF, uncF, unc[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
84.46 minutes |
MG1655: 3918911..3918441 | ||
|
NC_012967: 3881254..3880784 | ||||
|
W3110 |
|
W3110: 3715793..3716263 | ||
|
DH10B: 4016495..4016025 | ||||
|
NC_012759: 3806774..3807244 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔatpF (Keio:JW3714) |
deletion |
deletion |
PMID:16738554 | ||||
|
PMID:12519969 |
At position 159 in Plus orientation, contains plasmid pKD46. | ||||||
|
atpF469 | |||||||
|
ΔatpF765::kan |
PMID:16738554 |
| |||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3714 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAATCTTAACGCAACAATCCT Primer 2:CCaAGTTCAGCGACAAGTTTATC | |
|
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 14% [6] | |
|
Linked marker |
est. P1 cotransduction: 68% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
AtpF |
|---|---|
| Synonyms |
F0 sector of membrane-bound ATP synthase, subunit b[1], B3736[2][1], Unc[2][1], UncF[2][1], PapF[2][1], AtpF[2][1], B chain[2][1] |
| Product description |
ATP synthase, F0 complex, b subunit[2][3]; Component of b subunit complex[2][3]; ATP synthase, F0 complex[2][3]; ATP synthase[2][3] ATP synthase subunit b, membrane-bound, F0 sector[4] |
| EC number (for enzymes) | |
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0015986 |
ATP synthesis coupled proton transport |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002146 |
P |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0015078 |
hydrogen ion transmembrane transporter activity |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0375 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0006811 |
ion transport |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0406 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0006810 |
transport |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0046961 |
hydrogen ion transporting ATPase activity, rotational mechanism |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005864 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0015992 |
proton transport |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0375 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0016020 |
membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0397 |
C |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0016021 |
integral to membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0812 |
C |
Seeded from EcoCyc [8] |
complete | |
|
GO:0016469 |
proton-transporting two-sector ATPase complex |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002146 |
C |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0016820 |
hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR002146 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0045263 |
proton-transporting ATP synthase complex, coupling factor F(o) |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0138 |
C |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0046933 |
hydrogen ion transporting ATP synthase activity, rotational mechanism |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005864 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0031225 |
anchored to membrane |
PMID:2863271 |
IDA: Inferred from Direct Assay |
C |
Seeded from Riley et al 2006 [1]. |
complete | ||
|
GO:0005886 |
plasma membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc [8] |
complete | |
|
GO:0006754 |
ATP biosynthetic process |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0066 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0046872 |
metal ion binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0066 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0015986 |
ATP synthesis coupled proton transport |
PMID:2863271 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc 11.1[3]. |
complete | ||
|
Contributes to |
GO:0046961 |
hydrogen ion transporting ATPase activity, rotational mechanism |
PMID:2863271 |
IMP: Inferred from Mutant Phenotype |
F |
complete | ||
|
GO:0045263 |
proton-transporting ATP synthase complex, coupling factor F(o) |
PMID:6460031 |
IMP: Inferred from Mutant Phenotype |
C |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of b subunit complex |
could be indirect | ||
|
Protein |
Subunits of ATP synthase, F0 complex |
could be indirect | ||
|
Protein |
Subunits of ATP synthase |
could be indirect |
| |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
|
Inner Membrane |
PMID:6278247, PMID:9298646 |
| ||
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MNLNATILGQ AIAFVLFVLF CMKYVWPPLM AAIEKRQKEI ADGLASAERA HKDLDLAKAS ATDQLKKAKA EAQVIIEQAN KRRSQILDEA KAEAEQERTK IVAQAQAEIE AERKRAREEL RKQVAILAVA GAEKIIERSV DEAANSDIVD KLVAEL |
|---|---|
| Length |
156 |
| Mol. Wt |
17.263 kDa |
| pI |
6.6 (calculated) |
| Extinction coefficient |
6,990 - 7,115 (calc based on 1 Y, 1 W, and 1 C residues) |
| edit table |
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for atpF | |
|
microarray |
Summary of data for atpF from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Accessions Related to atpF Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
ATPF |
From SHIGELLACYC |
|
E. coli O157 |
ATPF |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 7.7 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 8.0 8.1 8.2 8.3 8.4 8.5 8.6 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
Categories
