PortEco logo

atpG:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

atpG

Mnemonic

ATP

Synonyms

ECK3726, b3733, JW3711, papC, uncG, unc[1]

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

84.39 minutes, 84.39 minutes 

MG1655: 3916288..3915425


REL606

NC_012967: 3878631..3877768


BW2952

NC_012759: 3803758..3804621


W3110

 

W3110: 3718416..3719279


DH10B

DH10B: 4013872..4013009


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3915428

Edman degradation

PMID:7508444[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔatpG (Keio:JW3711)

deletion

deletion

PMID:16738554[3]

Shigen

atpG428

CGSC:7266


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3711

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCGCCGGCGCAAAAGAGATACG

Primer 2:CCAACCGCGGCGGCCCCCGAGAC

2A1

Kohara Phage

Genobase

PMID:3038334[5]

zid-501::Tn10

Linked marker

CAG18499 = CGSC7458[6]

est. P1 cotransduction: 17% [7]

rbsD296::Tn10

Linked marker

CAG18501 = CGSC7460[6]

est. P1 cotransduction: 60% [7]
Synonyms:zie-296::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10104

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000100

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948243

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0102

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012211

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Tang, C et al. (1994) Structure of the gamma subunit of Escherichia coli F1 ATPase probed in trypsin digestion and biotin-avidin binding studies. J. Biol. Chem. 269 4467-72 PubMed EcoliWiki page
  3. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  5. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  6. 6.0 6.1 CGSC: The Coli Genetics Stock Center
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories