PortEco logo

atpG:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

atpG

Gene Synonym(s)

ECK3726, b3733, JW3711, papC, uncG, unc[1]

Product Desc.

ATP synthase, F1 complex, γ subunit[2][3];

Component of ATP synthase, F1 complex[2][3]; ATP synthase[2][3]

ATP synthase subunit gamma, membrane-bound, F1 sector[4]

Product Synonyms(s)

F1 sector of membrane-bound ATP synthase, gamma subunit[1], B3733[2][1], Unc[2][1], UncG[2][1], PapC[2][1], AtpG[2][1] , ECK3726, JW3711, papC, uncG, b3733

Function from GO

Cellular Component

Molecular Function

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): atpBEFHAGDC[2], atpIBEFHAGDC[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]


HT_Cmplx10_Mem: AtpA+AtpD+AtpG.[4]



Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

atpG

Mnemonic

ATP

Synonyms

ECK3726, b3733, JW3711, papC, uncG, unc[1]

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

84.39 minutes, 84.39 minutes 

MG1655: 3916288..3915425


REL606

NC_012967: 3878631..3877768


BW2952

NC_012759: 3803758..3804621


W3110

 

W3110: 3718416..3719279


DH10B

DH10B: 4013872..4013009


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3915428

Edman degradation

PMID:7508444


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔatpG (Keio:JW3711)

deletion

deletion

PMID:16738554

Shigen

atpG428

CGSC:7266


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3711

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGCCGGCGCAAAAGAGATACG

Primer 2:CCAACCGCGGCGGCCCCCGAGAC

2A1

Kohara Phage

Genobase

PMID:3038334

zid-501::Tn10

Linked marker

CAG18499 = CGSC7458[5]

est. P1 cotransduction: 17% [6]

rbsD296::Tn10

Linked marker

CAG18501 = CGSC7460[5]

est. P1 cotransduction: 60% [6]
Synonyms:zie-296::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10104

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000100

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948243

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0102

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012211

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

AtpG

Synonyms

F1 sector of membrane-bound ATP synthase, gamma subunit[1], B3733[2][1], Unc[2][1], UncG[2][1], PapC[2][1], AtpG[2][1] , ECK3726, JW3711, papC, uncG, b3733

Product description

ATP synthase, F1 complex, γ subunit[2][3];

Component of ATP synthase, F1 complex[2][3]; ATP synthase[2][3]

ATP synthase subunit gamma, membrane-bound, F1 sector[4]

EC number (for enzymes)

Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0005524

ATP binding

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00815

F

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0997

C

Seeded from EcoCyc (v14.0)

complete

GO:0045261

proton-transporting ATP synthase complex, catalytic core F(1)

PMID:2863270

IMP: Inferred from Mutant Phenotype

C

Component of F1 ATP synthase, with gene products of uncA (alpha), uncD (beta), uncH (delta) and uncC (epsilon) - for review see Chapter 19 of Escherichia coli and Salmonella: Cellular and Molecular Biology, 2nd Edition.

complete

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-1003

C

Seeded from EcoCyc (v14.0)

complete

Contributes to

GO:0046933

hydrogen ion transporting ATP synthase activity, rotational mechanism

PMID:2863270

IDA: Inferred from Direct Assay

F

complete

GO:0015986

ATP synthesis coupled proton transport

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000131

P

Seeded from EcoCyc (v14.0)

complete

GO:0016020

membrane

PMID:16858726

IDA: Inferred from Direct Assay

C

Seeded from EcoCyc (v14.0)

complete

GO:0019898

extrinsic to membrane

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-9903

C

Seeded from EcoCyc (v14.0)

complete

GO:0045261

proton-transporting ATP synthase complex, catalytic core F(1)

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000131

C

Seeded from EcoCyc (v14.0)

complete

GO:0045261

proton-transporting ATP synthase complex, catalytic core F(1)

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0139

C

Seeded from EcoCyc (v14.0)

complete

GO:0046933

hydrogen ion transporting ATP synthase activity, rotational mechanism

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_00815

F

Seeded from EcoCyc (v14.0)

complete

GO:0046933

hydrogen ion transporting ATP synthase activity, rotational mechanism

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000131

F

Seeded from EcoCyc (v14.0)

complete

GO:0046961

proton-transporting ATPase activity, rotational mechanism

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000131

F

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

Subunits of ATP synthase, F1 complex

could be indirect

Protein

atpA

PMID:15690043

Experiment(s):EBI-878843, EBI-881946

Protein

atpC

PMID:15690043

Experiment(s):EBI-878843, EBI-881946

Protein

atpD

PMID:15690043

Experiment(s):EBI-878843

Protein

rplW

PMID:15690043

Experiment(s):EBI-881946

Protein

recJ

PMID:19402753

MALDI(Z-score):22.340308

Protein

recQ

PMID:19402753

MALDI(Z-score):26.376499

Protein

atpD

PMID:19402753

MALDI(Z-score):17.053160

Protein

atpC

PMID:19402753

LCMS(ID Probability):99.6 MALDI(Z-score):17.053160

Protein

atpA

PMID:19402753

LCMS(ID Probability):99.6 MALDI(Z-score):17.053160

Protein

Subunits of ATP synthase

could be indirect


Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

plasma membrane

From EcoCyc[3]

Cytoplasm

PMID:7508444, PMID:2900236

EchoLocation:atpG


Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MAGAKEIRSK IASVQNTQKI TKAMEMVAAS KMRKSQDRMA ASRPYAETMR KVIGHLAHGN
LEYKHPYLED RDVKRVGYLV VSTDRGLCGG LNINLFKKLL AEMKTWTDKG VQCDLAMIGS
KGVSFFNSVG GNVVAQVTGM GDNPSLSELI GPVKVMLQAY DEGRLDKLYI VSNKFINTMS
QVPTISQLLP LPASDDDDLK HKSWDYLYEP DPKALLDTLL RRYVESQVYQ GVVENLASEQ
AARMVAMKAA TDNGGSLIKE LQLVYNKARQ ASITQELTEI VSGAAAV
Length

287

Mol. Wt

31.577 kDa

pI

9.1 (calculated)

Extinction coefficient

27,390 - 27,640 (calc based on 11 Y, 2 W, and 2 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

2..287

PF00231 ATP synthase

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16131601

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:948243

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012211

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0ABA6

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10104

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:948243

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000100

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0102

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MC4100

7.79E+02

molecules/cell

  • Medium: median data from rich and minimal media
  • Temperature (°C): 37
  • Doubling time (min): Growth Rate(min):
  • Growth phase: other:

emPAI

PMID:18304323

Protein

Ecoli K-12

66.565+/-0.653

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

1.037079954

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

9832

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

3131

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

6674

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

atpBEFHAGDC

atpIBEFHAGDC

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b3733 (EcoliWiki Page)

NCBI GEO profiles for atpG

microarray

GenExpDB:b3733 (EcoliWiki Page)

Summary of data for atpG from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

Notes

Accessions Related to atpG Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10104

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0102

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3733

EcoGene

EcoGene:EG10104

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000100

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012211

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000010167 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Arabidopsis thaliana

  • AT1G15700 (score: 1.000; bootstrap: 83%)
  • AT4G04640 (score: 0.544)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000018505 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00041042 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00022089 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000007480 (score: 1.000; bootstrap: 100%)
  • ENSCAFP00000022132 (score: 0.549)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-030131-8901 (score: 1.000; bootstrap: 100%)
  • ZDB-CDNA-040425-1566 (score: 0.998)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0184316 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0020235 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA20479-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000010899 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000349142 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000012071 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000020878 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Mus musculus

  • MGI:1261437 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Oryza gramene

  • Q8RU25 (score: 1.000; bootstrap: 80%)
  • Q7G601 (score: 1.000; bootstrap: 82%)
  • Q710Q5 (score: 0.283)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000044643 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YBR039W (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPBC17343 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000140728 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000003951 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

ATPG

From SHIGELLACYC

E. coli O157

ATPG

From ECOO157CYC


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00231 ATP synthase

Superfamily (EcoliWiki Page)

SUPERFAMILY:52943

Panther (EcoliWiki Page)

PTHR11693:SF10

EcoCyc

EcoCyc:EG10104

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10104

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000100

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0102

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012211

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]