PortEco logo

bamB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

bamB

Mnemonic

Beta-barrel assembly machine

Synonyms

ECK2508, b2512, JW2496, bamB , yfgL[1][2], yfgL

Notes

A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).

The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest [2].

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

56.8 minutes 

MG1655: 2636674..2635496


REL606

NC_012967: 2559471..2558293


BW2952

NC_012759: 2521301..2522479


W3110

 

W3110: 2637308..2636130


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔyfgL (Keio:JW2496)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC9989[4]

yfgL S172C

S172C

Can be cross-linked using cysteine-specific crosslinkers to YaeT (BamA).

PMID:18165306[5]


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2496

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCCAATTGCGTAAATTACTGCT

Primer 2:CCACGTGTAATAGAGTACACGGT

purC80::Tn10

Linked marker

CAG18470 = CGSC7413[4]

est. P1 cotransduction: 16% [7]

zfh-208::Tn10

Linked marker

CAG18481 = CGSC7417[4]

est. P1 cotransduction: 35% [7]
Synonyms:zff-208::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7320

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG14208

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120003892

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946982

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB3960

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0008272

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  3. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Vuong, P et al. (2008) Analysis of YfgL and YaeT interactions through bioinformatics, mutagenesis, and biochemistry. J. Bacteriol. 190 1507-17 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories