E. coli is indeed the coolest thing on the planet - Carl Zimmer
cadB:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
cadB |
|---|---|
| Mnemonic | |
| Synonyms |
ECK4126, b4132, JW4093[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
93.9 minutes |
MG1655: 4358054..4356720 | ||
|
W3110 |
|
W3110: 4364709..4363375 | ||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔcadB (Keio:JW4093) |
deletion |
deletion | |||||
|
cadB2231::Tn10 |
Insertion at 4,357,381 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[4] |
Synonyms: zjd-2231::Tn10 | ||||
|
cadB2231::Tn10 | |||||||
|
cadB3182::Tn10kan | |||||||
|
ΔcadB759::kan |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4093 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTTCTGCCAAGAAGATCGG Primer 2:CCATGTGCGTTAGACGCGGTGTG | |
|
Linked marker |
est. P1 cotransduction: 9% [4] | ||
|
Linked marker |
est. P1 cotransduction: 2% [4] | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 4.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 5.0 5.1 Nichols BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J Bacteriol 180: 6408-11 PubMed EcoliWiki page
- ↑ Singer M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol Rev 53: 1-24 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
