Try the new EcoliHub and let us know what you'd like to see.
caiB:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
caiB |
|---|---|
| Mnemonic |
Carnitine inducible |
| Synonyms |
ECK0039, b0038, JW0037, yaaN[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.82 minutes |
MG1655: 39115..37898 | ||
|
W3110 |
|
W3110: 39115..37898 | ||
|
DH10B: 39115..37898 | ||||
|
NC_012759: 37898..39115 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
caiBT302A |
T302A |
(in strain: O44:K74) |
Strain variation; seeded from UniProt:P31572 | ||||
|
caiBV187A |
V187A |
(in strain: O44:K74) |
Strain variation; seeded from UniProt:P31572 | ||||
|
ΔcaiB (Keio:JW0037) |
deletion |
deletion |
| ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0037 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGATCATCTACCCATGCCGAA Primer 2:CCGTCCTCAACTTTGGCCAGACC | |
|
Linked marker |
est. P1 cotransduction: 83% [5] | ||
|
leuO3051::Tn10 |
Linked marker |
est. P1 cotransduction: 13% [5] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
