Try the new EcoliHub and let us know what you'd like to see.
clpB:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
clpB |
|---|---|
| Mnemonic |
Caseinolytic protease |
| Synonyms |
ECK2590, b2592, JW2573, htpM[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
58.83 minutes |
MG1655: 2732195..2729622 | ||
|
NC_012967: 2655581..2653008 | ||||
|
W3110 |
|
W3110: 2732829..2730256 | ||
|
DH10B: 2823960..2821387 | ||||
|
NC_012759: 2615434..2618007 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
clpBR819A |
R819A |
Loss of ability to form oligomers; loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
clpBE826A |
E826A |
No effect |
seeded from UniProt:P63284 | ||||
|
clpBGAR813AAA |
GAR813AAA |
No effect on oligomerization |
seeded from UniProt:P63284 | ||||
|
clpBR815A |
R815A |
Loss of ability to form oligomers; loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
clpBR756A |
R756A |
No effect on oligomerization. Loss of ATPase activity |
seeded from UniProt:P63284 | ||||
|
clpBD797A |
D797A |
No effect |
seeded from UniProt:P63284 | ||||
|
clpBE678A |
E678A |
No effect on oligomerization |
seeded from UniProt:P63284 | ||||
|
clpBK611T |
K611T |
No effect on ability to form oligomers. Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
clpBE257A |
E257A |
Decrease in ability to disaggregate proteins due to decreased substrate- binding activity. Retains hexameric quaternary structure and ATPase activity; when associated with A-254 |
seeded from UniProt:P63284 | ||||
|
clpBE279A |
E279A |
No effect on oligomerization |
seeded from UniProt:P63284 | ||||
|
clpBW543F |
W543F |
No effect on chaperone activity or ability to form oligomers |
seeded from UniProt:P63284 | ||||
|
clpBY251A |
Y251A |
Decrease in ability to disaggregate proteins due to decreased substrate- binding activity. Retains hexameric quaternary structure and ATPase activity |
seeded from UniProt:P63284 | ||||
|
clpBR332A |
R332A |
Loss of ability to form oligomers |
seeded from UniProt:P63284 | ||||
|
clpBE254A |
E254A |
Decrease in ability to disaggregate proteins due to decreased substrate- binding activity. Retains hexameric quaternary structure and ATPase activity; when associated with A-257 |
seeded from UniProt:P63284 | ||||
|
clpBK212T |
K212T |
Loss of ability to form oligomers even in the presence of ATP. Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
clpBE109A |
E109A |
Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
clpBL110Q |
L110Q |
30% decrease in chaperone activity; retains ATPase activity |
seeded from UniProt:P63284 | ||||
|
clpBS84A |
S84A |
No effect |
seeded from UniProt:P63284 | ||||
|
clpBL93Q |
L93Q |
Loss of chaperone activity. Retains ATPase activity |
seeded from UniProt:P63284 | ||||
|
clpBL97Q |
L97Q |
75% decrease in chaperone activity; retains ATPase activity |
seeded from UniProt:P63284 | ||||
|
clpBD103A |
D103A |
Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
clpBT7A |
T7A |
Loss of chaperone activity |
seeded from UniProt:P63284 | ||||
|
ΔclpB (Keio:JW2573) |
deletion |
deletion | |||||
|
clpB102(del-ins)::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2573 |
Plasmid clone |
Status:Clone OK Primer 1:GCCCGTCTGGATCGTCTTACTAA Primer 2:CCtTGGACGGCGACAATCCGGTC | |
|
Linked marker |
est. P1 cotransduction: 48% [6] | ||
|
Linked marker |
est. P1 cotransduction: 77% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ Squires CL et al. (1991) ClpB is the Escherichia coli heat shock protein F84.1. J Bacteriol 173: 4254-62 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
