Try the new EcoliHub and let us know what you'd like to see.
dnaJ:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaJ |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK0015, b0015, JW0014, groP, grpC[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.31 minutes |
MG1655: 14168..15298 | ||
|
NC_012967: 14166..15296 | ||||
|
W3110 |
|
W3110: 14168..15298 | ||
|
DH10B: 14168..15298 | ||||
|
NC_012759: 14168..15298 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
dnaJC144S |
C144S |
Loss of dnaK-independent chaperone activity; when associated with S-147; S- 197 and S-200 |
seeded from UniProt:P08622 | ||||
|
dnaJC161H |
C161H |
No effect on chaperone function; when associated with H-183 |
seeded from UniProt:P08622 | ||||
|
dnaJC147S |
C147S |
Loss of dnaK-independent chaperone activity; when associated with S-144; S- 197 and S-200 |
seeded from UniProt:P08622 | ||||
|
dnaJKE51AA |
KE51AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJY54A |
Y54A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJE55A |
E55A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJTD58AA |
TD58AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJDQ67AA |
DQ67AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJSQ60AA |
SQ60AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJKR62AA |
KR62AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJKE48AA |
KE48AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJKE41AA |
KE41AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJE44A |
E44A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJK46A |
K46A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJF47A |
F47A |
Loss of function |
seeded from UniProt:P08622 | ||||
|
dnaJMK30AA |
MK30AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJY32A |
Y32A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJH33Q |
H33Q |
Loss of ability to stimulate dnaK ATPase activity |
seeded from UniProt:P08622 | ||||
|
dnaJQ38A |
Q38A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJP34F |
P34F |
Loss of function |
seeded from UniProt:P08622 | ||||
|
dnaJD35N |
D35N |
Loss of ability to bind dnaK |
seeded from UniProt:P08622 | ||||
|
dnaJR36A |
R36A |
Decrease in chaperone function |
seeded from UniProt:P08622 | ||||
|
dnaJN37A |
N37A |
Decrease in chaperone function |
seeded from UniProt:P08622 | ||||
|
dnaJL28A |
L28A |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJRE19AA |
RE19AA |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJY25A |
Y25A |
Loss of activity |
seeded from UniProt:P08622 | ||||
|
dnaJK26A |
K26A |
Loss of activity |
seeded from UniProt:P08622 | ||||
|
dnaJA29G |
A29G |
No effect |
seeded from UniProt:P08622 | ||||
|
dnaJR27A |
R27A |
No effect |
seeded from UniProt:P08622 | ||||
|
ΔdnaJ (Keio:JW0014) |
deletion |
deletion | |||||
|
dnaJC161S |
C161S |
Loss of function; when associated with S-164; S-183 and S-186 |
seeded from UniProt:P08622 | ||||
|
dnaJC164H |
C164H |
No effect on chaperone function; when associated with H-183 |
seeded from UniProt:P08622 | ||||
|
dnaJC164S |
C164S |
Loss of function; when associated with S-161; S-183 and S-186 |
seeded from UniProt:P08622 | ||||
|
dnaJC186H |
C186H |
No effect on chaperone function |
seeded from UniProt:P08622 | ||||
|
dnaJC186S |
C186S |
Loss of function; when associated with S-161; S-164 and S-184 |
seeded from UniProt:P08622 | ||||
|
dnaJC197S |
C197S |
Loss of dnaK-independent chaperone activity; when associated with S-144; S- 147 and S-200 |
seeded from UniProt:P08622 | ||||
|
dnaJC183H |
C183H |
No effect on chaperone function. Same effect; when associated with H-161 or H-164 |
seeded from UniProt:P08622 | ||||
|
dnaJC183S |
C183S |
Loss of function; when associated with S-161; S-164 and S-186 |
seeded from UniProt:P08622 | ||||
|
dnaJC200S |
C200S |
Loss of dnaK-independent chaperone activity; when associated with S-144; S- 147 and S-197 |
seeded from UniProt:P08622 | ||||
|
dnaJ259(ts) |
temperature sensitive | ||||||
|
ΔdnaJ735::kan | |||||||
|
ΔdnaJ |
| ||||||
|
Strain BW2952 |
T5C |
A2V |
Nonsynonomous mutation |
This is a difference relative to E. coli K-12 MG1655. | |||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0014 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCTAAGCAAGATTATTACGA Primer 2:CCGCGGGTCAGGTCGTCAAAAAA | |
|
Linked marker |
est. P1 cotransduction: 61% [7] | ||
|
Linked marker |
est. P1 cotransduction: 52% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Sell SM et al. (1990) Isolation and characterization of dnaJ null mutants of Escherichia coli. J Bacteriol 172: 4827-35 PubMed EcoliWiki page
- ↑ Ferenci T et al. (2009) Genomic sequencing reveals regulatory mutations and recombinational events in the widely used MC4100 lineage of Escherichia coli K-12. J Bacteriol 191: 4025-9 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
