Try the new EcoliHub and let us know what you'd like to see.
dnaK:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
dnaK |
|---|---|
| Gene Synonym(s) |
ECK0014, b0014, JW0013, grpF, seg, lop, groPAB, groPC, groPF, grpC, dnaL, groP, groPA[1][2] |
| Product Desc. |
chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins[2][3]; Component of DnaJ/DnaK/GrpE[2][3] Hsp70 molecular chaperone, heat-inducible[4] |
| Product Synonyms(s) |
chaperone Hsp70, co-chaperone with DnaJ[1], B0014[2][1], GrpC[2][1], GrpF[2][1], Seg[2][1], GroP[2][1], DnaL[2][1], DnaK[2][1] |
| Function from GO |
Molecular Function Cellular Component Biological Process |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
ATP-regulated binding and release of polypeptide substrates. Binds Zn(II). DnaJ is co-chaperone. Role in the initiation of DNA replication. DnaK has secondary amide peptide bond cis-trans isomerase (APIase) activity. A dnaK mutant is inviable above 42C, or below 8C (as enabled by transgenic Oleispira antarctica Cpn10/60). Delta tig delta dnaK mutants are synthetic lethal at 30 degrees C, however, no lethal effects are observed at 23 degrees C; overproduction of GroEL/GroES at 30 degrees C supresses synthetic lethality. dnaK, hscA, hscC and yegD are paralogs. HT_Cmplx22_Cyt: DnaK+GrpE+GyrA+RpsA. HT_Cmplx30_Mem: ClpB+DnaK+InfB+RpsA. After four hours of Zn(II) stress, protein levels increased (Easton, 2006).[4]
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
dnaK |
|---|---|
| Mnemonic |
DNA |
| Synonyms |
ECK0014, b0014, JW0013, grpF, seg, lop, groPAB, groPC, groPF, grpC, dnaL, groP, groPA[1][2] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.26 minutes |
MG1655: 12163..14079 | ||
|
NC_012967: 12161..14077 | ||||
|
W3110 |
|
W3110: 12163..14079 | ||
|
DH10B: 12163..14079 | ||||
|
NC_012759: 12163..14079 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔdnaK (Keio:JW0013) |
deletion |
deletion |
PMID:16738554 | ||||
|
dnaKG32D |
G32D |
In SEG-1 and dnaK756(TS); confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaKV436I |
V436I |
In mutant SEG-2; confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaKG455D |
G455D |
In mutant dnaK756(TS); confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaKG468D |
G468D |
In mutant dnaK756(TS); confers temperature sensitivity |
seeded from UniProt:P0A6Y8 | ||||
|
dnaK756(ts) |
temperature sensitive | ||||||
|
ΔdnaK734::kan |
PMID:16738554 |
| |||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0013 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGGTAAAATAATTGGTATCGA Primer 2:CCTTTTTTGTCTTTGACTTCTTC | |
|
Linked marker |
est. P1 cotransduction: 66% [6] | ||
|
Linked marker |
est. P1 cotransduction: 48% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
DnaK |
|---|---|
| Synonyms |
chaperone Hsp70, co-chaperone with DnaJ[1], B0014[2][1], GrpC[2][1], GrpF[2][1], Seg[2][1], GroP[2][1], DnaL[2][1], DnaK[2][1] |
| Product description |
chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins[2][3]; Component of DnaJ/DnaK/GrpE[2][3] Hsp70 molecular chaperone, heat-inducible[4] |
| EC number (for enzymes) |
|
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0051082 |
unfolded protein binding |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012725 |
F |
Seeded from EcoCyc [7] |
complete | |
|
GO:0016020 |
membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc [7] |
complete | |
|
GO:0006950 |
response to stress |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0346 |
P |
Seeded from EcoCyc [7] |
complete | |
|
GO:0006457 |
protein folding |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR012725 |
P |
Seeded from EcoCyc [7] |
complete | |
|
GO:0006260 |
DNA replication |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0235 |
P |
Seeded from EcoCyc [7] |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0963 |
C |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005524 |
ATP binding |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR001023 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0000166 |
nucleotide binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0547 |
F |
Seeded from EcoCyc [7] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0A853 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0AAI5 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0AB71 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0AC38 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0AC81 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0ACX3 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0ADX9 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P12282 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P23721 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P28304 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P37342 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P45578 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:15690043 |
IPI: Inferred from Physical Interaction |
UniProtKB:P69924 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16139413 |
IPI: Inferred from Physical Interaction |
UniProtKB:P21513 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P00634 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P00811 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0A6Z3 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0A9Q9 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0AG80 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P0C0V0 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P10346 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P16700 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P17117 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P28635 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P30011 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P36677 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P37024 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P37685 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P46853 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P62623 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P68919 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P69822 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:P76002 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:Q46796 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005515 |
protein binding |
PMID:16606699 |
IPI: Inferred from Physical Interaction |
UniProtKB:Q46906 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005737 |
cytoplasm |
PMID:16858726 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc 12.5 [8] |
complete | ||
|
GO:0005886 |
plasma membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc [7] |
complete | |
|
GO:0006970 |
response to osmotic stress |
P |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
|
GO:0000910 |
cytokinesis |
P |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
|
GO:0008270 |
zinc ion binding |
PMID:11985624 |
IDA: Inferred from Direct Assay |
F |
complete | |||
|
GO:0009408 |
response to heat |
PMID:8349564 |
IEP: Inferred from Expression Pattern |
P |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of DnaJ/DnaK/GrpE |
could be indirect | ||
|
Protein |
htpG |
PMID:16606699 |
Experiment(s):EBI-1135316 | |
|
Protein |
aphA |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
gadA |
PMID:15690043 |
Experiment(s):EBI-883577, EBI-888455, EBI-893820 | |
|
Protein |
grpE |
PMID:15690043 |
Experiment(s):EBI-883577, EBI-881166, EBI-888219, EBI-890853 | |
|
Protein |
lon |
PMID:15690043 |
Experiment(s):EBI-883577 | |
|
Protein |
rplF |
PMID:15690043 |
Experiment(s):EBI-883577 | |
|
Protein |
rplJ |
PMID:15690043 |
Experiment(s):EBI-883577 | |
|
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-883577, EBI-890853 | |
|
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-883577, EBI-894882, EBI-890853 | |
|
Protein |
yibA |
PMID:15690043 |
Experiment(s):EBI-883577 | |
|
Protein |
ydcR |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
ydfJ |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
entB |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
fabB |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
hisC |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
hscA |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
narQ |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
pepB |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
proS |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
rplI |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
rpmG |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
sapA |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
tdcG |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
dcuD |
PMID:15690043 |
Experiment(s):EBI-890853 | |
|
Protein |
yihM |
PMID:15690043 |
Experiment(s):EBI-890853 | |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
|
Cytoplasm |
PMID:9298646, PMID:1396676, PMID:7783627 |
| ||
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MGKIIGIDLG TTNSCVAIMD GTTPRVLENA EGDRTTPSII AYTQDGETLV GQPAKRQAVT NPQNTLFAIK RLIGRRFQDE EVQRDVSIMP FKIIAADNGD AWVEVKGQKM APPQISAEVL KKMKKTAEDY LGEPVTEAVI TVPAYFNDAQ RQATKDAGRI AGLEVKRIIN EPTAAALAYG LDKGTGNRTI AVYDLGGGTF DISIIEIDEV DGEKTFEVLA TNGDTHLGGE DFDSRLINYL VEEFKKDQGI DLRNDPLAMQ RLKEAAEKAK IELSSAQQTD VNLPYITADA TGPKHMNIKV TRAKLESLVE DLVNRSIEPL KVALQDAGLS VSDIDDVILV GGQTRMPMVQ KKVAEFFGKE PRKDVNPDEA VAIGAAVQGG VLTGDVKDVL LLDVTPLSLG IETMGGVMTT LIAKNTTIPT KHSQVFSTAE DNQSAVTIHV LQGERKRAAD NKSLGQFNLD GINPAPRGMP QIEVTFDIDA DGILHVSAKD KNSGKEQKIT IKASSGLNED EIQKMVRDAE ANAEADRKFE ELVQTRNQGD HLLHSTRKQV EEAGDKLPAD DKTAIESALT ALETALKGED KAAIEAKMQE LAQVSQKLME IAQQQHAQQQ TAGADASANN AKDDDVVDAE FEEVKDKK |
|---|---|
| Length |
638 |
| Mol. Wt |
69.115 kDa |
| pI |
4.7 (calculated) |
| Extinction coefficient |
15,930 - 16,055 (calc based on 7 Y, 1 W, and 1 C residues) |
| edit table |
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for dnaK | |
|
microarray |
Summary of data for dnaK from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (11706..12211) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
Notes
Accessions Related to dnaK Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Danio rerio |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
DNAK |
From SHIGELLACYC |
|
E. coli O157 |
DNAK |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
- ↑ 8.00 8.01 8.02 8.03 8.04 8.05 8.06 8.07 8.08 8.09 8.10 8.11 8.12 8.13 8.14 8.15 8.16 8.17 8.18 8.19 8.20 8.21 8.22 8.23 8.24 8.25 8.26 8.27 8.28 8.29 8.30 8.31 8.32 8.33 8.34 8.35 8.36 8.37 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Genevaux P et al. (2007) The Hsp70 chaperone machines of Escherichia coli: a paradigm for the repartition of chaperone functions. Mol Microbiol 66: 840-57 PubMed EcoliWiki page
- ↑ Zaslaver A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat Methods 3: 623-8 PubMed EcoliWiki page
Categories
