PortEco logo

dnaX:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name
Mnemonic
Synonyms


Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

10.59 minutes 

MG1655: 491316..493247


REL606

NC_012967: 464159..466090


BW2952

NC_012759: 394075..396006


W3110

 

W3110: 491316..493247


DH10B

DH10B: 430647..432578


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

491319

Edman degradation

PMID:3283125[1]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

dnaX36

E601K

Growth Phenotype

ts growth. Fast stop DNA replication arrest at 44°

PMID:16430690[2] PMID:8376347[3]

Affects Tau but not Gamma

dnaX36

Weak mutator in mismatch repair deficient strain

PMID:16430690[2]

dnaX0

CGSC:10600

dnaX2016

G118D

Growth Phenotype

Ts for replication and growth

PMID:8376347[3]

CGSC:10601

dnaX36(ts)

temperature sensitive

CGSC:10704

dnaXE145A

E145A

failure to suppress parE10 when overexpressed

PMID:12535532[4]

dnaX(Ts)

G118D

Growth Phenotype

temperature sensitive for replication and growth

PMID:12775696[5]

phenotype suppressed by mutations in DnaA

Notes

The dnaX locus was identified by the J, Walker lab[6] as the site of one of several ts mutations in strain SG133, which was originally thought to contain a single mutation in dnaZ.[7]


Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0459

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCAGTTATCAGGTCTTAGCCCG

Primer 2:CCAATGGGGCGGATACTTTCTTC

8C4

Kohara Phage

Genobase

PMID:3038334[9]

12H5

Kohara Phage

Genobase

PMID:3038334[9]

zaj-3054::Tn10

Linked marker

CAG12017 = CGSC7339[10]

est. P1 cotransduction: 28% [11]
Synonyms:zba-3054::Tn10

gsk-3055::Tn10

Linked marker

CAG12154 = CGSC7341[10]

est. P1 cotransduction: 72% [11]
Synonyms:zbb-30-55::TnlO, zba-3055::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10245

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10245

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000239

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945105

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0241

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001633

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Maki, S & Kornberg, A (1988) DNA polymerase III holoenzyme of Escherichia coli. I. Purification and distinctive functions of subunits tau and gamma, the dnaZX gene products. J. Biol. Chem. 263 6547-54 PubMed EcoliWiki page
  2. 2.0 2.1 Pham, PT et al. (2006) Mutator mutants of Escherichia coli carrying a defect in the DNA polymerase III tau subunit. Mol. Microbiol. 59 1149-61 PubMed EcoliWiki page
  3. 3.0 3.1 Blinkova, A et al. (1993) The Escherichia coli DNA polymerase III holoenzyme contains both products of the dnaX gene, tau and gamma, but only tau is essential. J. Bacteriol. 175 6018-27 PubMed EcoliWiki page
  4. Espeli, O et al. (2003) Temporal regulation of topoisomerase IV activity in E. coli. Mol. Cell 11 189-201 PubMed EcoliWiki page
  5. Blinkova, A et al. (2003) Suppression of temperature-sensitive chromosome replication of an Escherichia coli dnaX(Ts) mutant by reduction of initiation efficiency. J. Bacteriol. 185 3583-95 PubMed EcoliWiki page
  6. Henson, JM et al. (1979) Isolation and characterization of dnaX and dnaY temperature-sensitive mutants of Escherichia coli. Genetics 92 1041-59 PubMed EcoliWiki page
  7. Sevastopoulos, CG et al. (1977) Large-scale automated isolation of Escherichia coli mutants with thermosensitive DNA replication. Proc. Natl. Acad. Sci. U.S.A. 74 3485-9 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  10. 10.0 10.1 CGSC: The Coli Genetics Stock Center
  11. 11.0 11.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories