PortEco logo

dnaX:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

dnaX

Gene Synonym(s)

ECK0464, b0470, JW0459, dnaZ[1], dnaZ

Product Desc.


DNA polymerase III holoenzyme, tau and gamma ATPase subunits; gamma chain (aa 1-431) is main subunit of the clamp loader complex[4]

Product Synonyms(s)

DNA polymerase III/DNA elongation factor III, tau and gamma subunits[1], DnaZ[2][1], B0470[2][1] , dnaZ, ECK0464, JW0459, b0470

Function from GO

Molecular Function

Biological Process

Cellular Component

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): dnaX[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]


The tau chain is the full length protein. The gamma chain is formed by programmed ribosomal frameshifting at codon 431 to a premature stop codon.[4]



Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name
Mnemonic
Synonyms


Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

10.59 minutes 

MG1655: 491316..493247


REL606

NC_012967: 464159..466090


BW2952

NC_012759: 394075..396006


W3110

 

W3110: 491316..493247


DH10B

DH10B: 430647..432578


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

491319

Edman degradation

PMID:3283125


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

dnaX36

E601K

Growth Phenotype

ts growth. Fast stop DNA replication arrest at 44°

PMID:16430690 PMID:8376347

Affects Tau but not Gamma

dnaX36

Weak mutator in mismatch repair deficient strain

PMID:16430690

dnaX0

CGSC:10600

dnaX2016

G118D

Growth Phenotype

Ts for replication and growth

PMID:8376347

CGSC:10601

dnaX36(ts)

temperature sensitive

CGSC:10704

dnaXE145A

E145A

failure to suppress parE10 when overexpressed

PMID:12535532

dnaX(Ts)

G118D

Growth Phenotype

temperature sensitive for replication and growth

PMID:12775696

phenotype suppressed by mutations in DnaA

Notes

The dnaX locus was identified by the J, Walker lab[5] as the site of one of several ts mutations in strain SG133, which was originally thought to contain a single mutation in dnaZ.[6]


Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0459

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAGTTATCAGGTCTTAGCCCG

Primer 2:CCAATGGGGCGGATACTTTCTTC

8C4

Kohara Phage

Genobase

PMID:3038334

12H5

Kohara Phage

Genobase

PMID:3038334

zaj-3054::Tn10

Linked marker

CAG12017 = CGSC7339[7]

est. P1 cotransduction: 28% [8]
Synonyms:zba-3054::Tn10

gsk-3055::Tn10

Linked marker

CAG12154 = CGSC7341[7]

est. P1 cotransduction: 72% [8]
Synonyms:zbb-30-55::TnlO, zba-3055::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10245

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10245

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000239

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945105

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0241

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001633

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

DnaX

Synonyms

DNA polymerase III/DNA elongation factor III, tau and gamma subunits[1], DnaZ[2][1], B0470[2][1] , dnaZ, ECK0464, JW0459, b0470

Product description


DNA polymerase III holoenzyme, tau and gamma ATPase subunits; gamma chain (aa 1-431) is main subunit of the clamp loader complex[4]

EC number (for enzymes)

2.7.7.7[1]

Notes

Function

[back to top]


Gene Ontology

DNA polymerase III

See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0043846

DNA polymerase III, DnaX complex

C

Missing: evidence, reference

GO:0003689

DNA clamp loader activity

F

Missing: evidence, reference

GO:0000166

nucleotide binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003593

F

Seeded from EcoCyc (v14.0)

complete

GO:0000166

nucleotide binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003593

F

Seeded from EcoCyc (v14.0)

complete

GO:0000166

nucleotide binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0547

F

Seeded from EcoCyc (v14.0)

complete

GO:0000166

nucleotide binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0547

F

Seeded from EcoCyc (v14.0)

complete

GO:0003677

DNA binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR008921

F

Seeded from EcoCyc (v14.0)

complete

GO:0003677

DNA binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR008921

F

Seeded from EcoCyc (v14.0)

complete

GO:0003887

DNA-directed DNA polymerase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

F

Seeded from EcoCyc (v14.0)

complete

GO:0003887

DNA-directed DNA polymerase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

F

Seeded from EcoCyc (v14.0)

complete

GO:0003887

DNA-directed DNA polymerase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:2.7.7.7

F

Seeded from EcoCyc (v14.0)

complete

GO:0003887

DNA-directed DNA polymerase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:2.7.7.7

F

Seeded from EcoCyc (v14.0)

complete

GO:0003887

DNA-directed DNA polymerase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0239

F

Seeded from EcoCyc (v14.0)

complete

GO:0003887

DNA-directed DNA polymerase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0239

F

Seeded from EcoCyc (v14.0)

complete

GO:0005515

protein binding

PMID:19703395

IPI: Inferred from Physical Interaction

UniProtKB:P0A988

F

Seeded from EcoCyc (v14.0)

complete

GO:0005515

protein binding

PMID:19703395

IPI: Inferred from Physical Interaction

UniProtKB:P0A988

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001270

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001270

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003959

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003959

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0067

F

Seeded from EcoCyc (v14.0)

complete

GO:0005524

ATP binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0067

F

Seeded from EcoCyc (v14.0)

complete

GO:0006260

DNA replication

PMID:391641

IMP: Inferred from Mutant Phenotype

P

complete

GO:0006260

DNA replication

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR008921

P

Seeded from EcoCyc (v14.0)

complete

GO:0017111

nucleoside-triphosphatase activity

PMID:11029431

IDA: Inferred from Direct Assay

F

complete

GO:0043846

DNA polymerase III, DnaX complex

PMID:8376347

IDA: Inferred from Direct Assay

C

complete

GO:0006260

DNA replication

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

P

Seeded from EcoCyc (v14.0)

complete

GO:0016887

ATPase activity

PMID:2681183

IDA: Inferred from Direct Assay

F

complete

GO:0006260

DNA replication

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0235

P

Seeded from EcoCyc (v14.0)

complete

GO:0030337

DNA polymerase processivity factor activity

PMID:11525729

IDA: Inferred from Direct Assay

F

complete

GO:0009360

DNA polymerase III complex

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

C

Seeded from EcoCyc (v14.0)

complete

GO:0030337

DNA polymerase processivity factor activity

PMID:7494000

IDA: Inferred from Direct Assay

F

complete

GO:0009360

DNA polymerase III complex

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR012763

C

Seeded from EcoCyc (v14.0)

complete

GO:0016740

transferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0808

F

Seeded from EcoCyc (v14.0)

complete

GO:0016740

transferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0808

F

Seeded from EcoCyc (v14.0)

complete

GO:0016779

nucleotidyltransferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0548

F

Seeded from EcoCyc (v14.0)

complete

GO:0016779

nucleotidyltransferase activity

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0548

F

Seeded from EcoCyc (v14.0)

complete

GO:0017111

nucleoside-triphosphatase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003593

F

Seeded from EcoCyc (v14.0)

complete

GO:0017111

nucleoside-triphosphatase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003593

F

Seeded from EcoCyc (v14.0)

complete


Interactions

DNA polymerase III

See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

Subunits of DNA polymerase III, preinitiation complex

could be indirect

Protein

rplA

PMID:15690043

Experiment(s):EBI-883400

Protein

fecB

PMID:15690043

Experiment(s):EBI-890677

Protein

nusG

PMID:15690043

Experiment(s):EBI-890677

Protein

rplL

PMID:15690043

Experiment(s):EBI-890677

Protein

rpmC

PMID:15690043

Experiment(s):EBI-890677

Protein

rpsF

PMID:15690043

Experiment(s):EBI-890677

Protein

ugpB

PMID:15690043

Experiment(s):EBI-890677

Protein

yfiF

PMID:15690043

Experiment(s):EBI-890677

Protein

yjgD

PMID:15690043

Experiment(s):EBI-890677

Protein

rhsD

PMID:16606699

Experiment(s):EBI-1136784

Protein

rpoC

PMID:16606699

Experiment(s):EBI-1136784

Protein

ugpB

PMID:19402753

LCMS(ID Probability):99.0

Protein

fecB

PMID:19402753

LCMS(ID Probability):99.0

Protein

Subunits of DNA polymerase III, holoenzyme

could be indirect

Protein

ParC from Topo IV


PMID:12535532

Microscopy- colocalization at the fork lost in dnaX mutant


Protein

subunits of the clamp loader

PMID:11525729

Protein

DnaB (Helicase)-Interacts with tau

PMID:10748120

Protein

alpha subunit of DNA Polymerase III- interacts with tau

PMID:10748120


Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Notes

Quantitation of DnaX products in replisomes shows three molecules of Tau and no Gamma at the replication fork [9].

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MSYQVLARKW RPQTFADVVG QEHVLTALAN GLSLGRIHHA YLFSGTRGVG KTSIARLLAK
GLNCETGITA TPCGVCDNCR EIEQGRFVDL IEIDAASRTK VEDTRDLLDN VQYAPARGRF
KVYLIDEVHM LSRHSFNALL KTLEEPPEHV KFLLATTDPQ KLPVTILSRC LQFHLKALDV
EQIRHQLEHI LNEEHIAHEP RALQLLARAA EGSLRDALSL TDQAIASGDG QVSTQAVSAM
LGTLDDDQAL SLVEAMVEAN GERVMALINE AAARGIEWEA LLVEMLGLLH RIAMVQLSPA
ALGNDMAAIE LRMRELARTI PPTDIQLYYQ TLLIGRKELP YAPDRRMGVE MTLLRALAFH
PRMPLPEPEV PRQSFAPVAP TAVMTPTQVP PQPQSAPQQA PTVPLPETTS QVLAARQQLQ
RVQGATKAKK SEPAAATRAR PVNNAALERL ASVTDRVQAR PVPSALEKAP AKKEAYRWKA
TTPVMQQKEV VATPKALKKA LEHEKTPELA AKLAAEAIER DPWAAQVSQL SLPKLVEQVA
LNAWKEESDN AVCLHLRSSQ RHLNNRGAQQ KLAEALSMLK GSTVELTIVE DDNPAVRTPL
EWRQAIYEEK LAQARESIIA DNNIQTLRRF FDAELDEESI RPI
Length

643

Mol. Wt

71.138 kDa

pI

6.8 (calculated)

Extinction coefficient

46,410 - 47,160 (calc based on 9 Y, 6 W, and 6 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

41..177

PF00004 ATPase family associated with various cellular activities (AAA)

PMID:19920124

Domain

416..498

PF12168 DNA polymerase III subunits tau domain IV DnaB-binding

PMID:19920124

Domain

232..372

PF12169 DNA polymerase III subunits gamma and tau domain III

PMID:19920124

Domain

499..640

PF12170 DNA polymerase III tau subunit V interacting with alpha

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16128454

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945105

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001633

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P06710

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10245

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10245

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945105

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000239

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0241

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]


Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
dnaX encodes two gene products from the same gene. A programmed frameshift is needed to generate the gamma subunit[10][11][12].

The amount of gamma is estimated to be about 20 molecules per cell, based on an estimate of 10 dimers[13]. However, while gamma purifies as a dimer, it is present as one subunit in the τ2γδδ'χψ DnaX complex.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

14.346+/-0.068

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.056447437

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

327

molecules/cell/generation

  • Medium:
  • Temperature (°C): 37

Ribosome Profiling

gamma isoform

PMID: 24766808

Protein

E. coli K-12 MG1655

84

molecules/cell/generation

  • Medium:
  • Temperature (°C): 37

Ribosome Profiling

gamma isoform

PMID: 24766808

Protein

E. coli K-12 MG1655

135

molecules/cell/generation

  • Medium:
  • Temperature (°C): 37

Ribosome Profiling

gamma isoform

PMID: 24766808

Protein

E. coli K-12 MG1655

196

molecules/cell/generation

  • Medium:
  • Temperature (°C): 37

Ribosome Profiling

tau isoform

PMID: 24766808

Protein

E. coli K-12 MG1655

85

molecules/cell/generation

  • Medium:
  • Temperature (°C): 37

Ribosome Profiling

tau isoform

PMID: 24766808

Protein

E. coli K-12 MG1655

134

molecules/cell/generation

  • Medium:
  • Temperature (°C): 37

Ribosome Profiling

tau isoform

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

dnaX

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b0470 (EcoliWiki Page)

NCBI GEO profiles for dnaX

microarray

GenExpDB:b0470 (EcoliWiki Page)

Summary of data for dnaX from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (491102..491347) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ10; Well:C6[14]

Notes

Accessions Related to dnaX Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10245

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0241

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b0470

EcoGene

EcoGene:EG10245

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000239

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001633

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Shigella flexneri

DNAX

From SHIGELLACYC

E. coli O157

DNAX

From ECOO157CYC

Anopheles gambiae

  • ENSANGP00000009446 (score: 1.000; bootstrap: 100%)
  • ENSANGP00000009970 (score: 0.227)
  • ENSANGP00000020452 (score: 0.200)
  • ENSANGP00000019592 (score: 0.060)

From Inparanoid:20070104

Apis mellifera

  • ENSAPMP00000020376 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Arabidopsis thaliana

  • AT4G24790 (score: 1.000; bootstrap: 99%)
  • AT1G14460 (score: 0.150)
  • AT2G02480 (score: 0.145)
  • AT5G45720 (score: 0.116)
  • AT4G18820 (score: 0.108)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000029589 (score: 1.000; bootstrap: 100%)
  • ENSBTAP00000019600 (score: 0.242)
  • ENSBTAP00000024740 (score: 0.220)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00041450 (score: 1.000; bootstrap: 100%)
  • WBGene00041400 (score: 0.204)
  • WBGene00042646 (score: 0.163)
  • WBGene00036412 (score: 0.163)
  • WBGene00025012 (score: 0.056)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00018409 (score: 1.000; bootstrap: 100%)
  • WBGene00004340 (score: 0.184)
  • WBGene00004338 (score: 0.182)
  • WBGene00004339 (score: 0.062)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000014551 (score: 1.000; bootstrap: 100%)
  • ENSCAFP00000020162 (score: 0.230)
  • ENSCAFP00000017619 (score: 0.227)

From Inparanoid:20070104

Ciona intestinalis

  • ENSCINP00000006132 (score: 1.000; bootstrap: 100%)
  • ENSCINP00000011627 (score: 1.000; bootstrap: 100%)
  • ENSCINP00000010059 (score: 0.238)
  • ENSCINP00000014206 (score: 0.085)

From Inparanoid:20070104

Danio rerio

  • ZDB-GENE-040907-1 (score: 1.000; bootstrap: 100%)
  • ZDB-CDNA-050522-313 (score: 1.000; bootstrap: 100%)
  • ZDB-GENE-040824-3 (score: 0.250)
  • ZDB-CDNA-050306-29 (score: 0.243)
  • ZDB-GENE-050306-29 (score: 0.243)
  • ZDB-CDNA-040425-3129 (score: 0.141)
  • ZDB-CDNA-040425-743 (score: 0.060)
  • ZDB-GENE-020809-3 (score: 0.060)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0232233 (score: 1.000; bootstrap: 100%)
  • DDB0232229 (score: 0.262)
  • DDB0232231 (score: 0.197)
  • DDB0232232 (score: 0.058)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0030871 (score: 1.000; bootstrap: 100%)
  • FBgn0032244 (score: 0.218)
  • FBgn0015287 (score: 0.179)
  • FBgn0028700 (score: 0.059)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA20846-PA (score: 1.000; bootstrap: 100%)
  • GA13416-PA (score: 0.198)
  • GA19473-PA (score: 0.053)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000014146 (score: 1.000; bootstrap: 100%)
  • ENSGALP00000001978 (score: 0.221)
  • ENSGALP00000027512 (score: 0.089)

From Inparanoid:20070104

Homo sapiens

  • ENSP00000229043 (score: 1.000; bootstrap: 100%)
  • ENSP00000296273 (score: 0.236)
  • ENSP00000055077 (score: 0.234)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000013401 (score: 1.000; bootstrap: 100%)
  • ENSMMUP00000005124 (score: 0.237)
  • ENSMMUP00000004943 (score: 0.200)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000019178 (score: 1.000; bootstrap: 100%)
  • ENSMODP00000026610 (score: 0.256)
  • ENSMODP00000023216 (score: 0.137)
  • ENSMODP00000012200 (score: 0.056)

From Inparanoid:20070104

Mus musculus

  • MGI:1919401 (score: 1.000; bootstrap: 100%)
  • MGI:2146571 (score: 0.222)
  • MGI:1341868 (score: 0.220)

From Inparanoid:20070104

Oryza gramene

  • Q6YZ54 (score: 1.000; bootstrap: 100%)
  • Q9FXT5 (score: 0.989)
  • Q9FXM3 (score: 0.200)
  • Q7XRX1 (score: 0.197)
  • Q948P2 (score: 0.197)
  • Q84N07 (score: 0.064)
  • Q852K3 (score: 0.063)

From Inparanoid:20070104

Pan troglodytes

  • ENSPTRP00000027044 (score: 1.000; bootstrap: 100%)
  • ENSPTRP00000032987 (score: 0.137)
  • ENSPTRP00000009832 (score: 0.079)

From Inparanoid:20070104

Rattus norvegicus

  • ENSRNOP00000001498 (score: 1.000; bootstrap: 100%)
  • ENSRNOP00000048060 (score: 0.718)
  • ENSRNOP00000002487 (score: 0.230)
  • ENSRNOP00000001989 (score: 0.216)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YJR068W (score: 1.000; bootstrap: 100%)
  • YNL290W (score: 0.185)
  • YOL094C (score: 0.167)
  • YBR087W (score: 0.066)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPAC27E20c (score: 1.000; bootstrap: 100%)
  • SPAC23D32 (score: 0.213)
  • SPAC16873c (score: 0.186)

From Inparanoid:20070104

Takifugu rubripes

  • NEWSINFRUP00000164364 (score: 1.000; bootstrap: 100%)
  • NEWSINFRUP00000156214 (score: 0.252)
  • NEWSINFRUP00000128611 (score: 0.241)
  • NEWSINFRUP00000170318 (score: 0.064)

From Inparanoid:20070104

Tetraodon nigroviridis

  • GSTENP00029055001 (score: 1.000; bootstrap: 100%)
  • GSTENP00027867001 (score: 0.235)
  • GSTENP00019812001 (score: 0.235)
  • GSTENP00018858001 (score: 0.060)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000002222 (score: 1.000; bootstrap: 63%)

From Inparanoid:20070104


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00004 ATPase family associated with various cellular activities (AAA)

Superfamily (EcoliWiki Page)

SUPERFAMILY:48019

Superfamily (EcoliWiki Page)

SUPERFAMILY:52540

Pfam (EcoliWiki Page)

PF12168 DNA polymerase III subunits tau domain IV DnaB-binding

Pfam (EcoliWiki Page)

PF12169 DNA polymerase III subunits gamma and tau domain III

Pfam (EcoliWiki Page)

PF12170 DNA polymerase III tau subunit V interacting with alpha

EcoCyc

EcoCyc:EG10245

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10245

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000239

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0241

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001633

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 3.9 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. Henson, JM et al. (1979) Isolation and characterization of dnaX and dnaY temperature-sensitive mutants of Escherichia coli. Genetics 92 1041-59 PubMed EcoliWiki page
  6. Sevastopoulos, CG et al. (1977) Large-scale automated isolation of Escherichia coli mutants with thermosensitive DNA replication. Proc. Natl. Acad. Sci. U.S.A. 74 3485-9 PubMed EcoliWiki page
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  9. Reyes-Lamothe, R et al. (2010) Stoichiometry and architecture of active DNA replication machinery in Escherichia coli. Science 328 498-501 PubMed EcoliWiki page
  10. Tsuchihashi, Z & Kornberg, A (1990) Translational frameshifting generates the gamma subunit of DNA polymerase III holoenzyme. Proc. Natl. Acad. Sci. U.S.A. 87 2516-20 PubMed EcoliWiki page
  11. Blinkowa, AL & Walker, JR (1990) Programmed ribosomal frameshifting generates the Escherichia coli DNA polymerase III gamma subunit from within the tau subunit reading frame. Nucleic Acids Res. 18 1725-9 PubMed EcoliWiki page
  12. Flower, AM & McHenry, CS (1990) The gamma subunit of DNA polymerase III holoenzyme of Escherichia coli is produced by ribosomal frameshifting. Proc. Natl. Acad. Sci. U.S.A. 87 3713-7 PubMed EcoliWiki page
  13. Hübscher, U & Kornberg, A (1980) The dnaZ protein, the gamma subunit of DNA polymerase III holoenzyme of Escherichia coli. J. Biol. Chem. 255 11698-703 PubMed EcoliWiki page
  14. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed EcoliWiki page

Categories

[back to top]