Try the new EcoliHub and let us know what you'd like to see.
endA:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
endA |
|---|---|
| Mnemonic |
Endonuclease |
| Synonyms |
ECK2940, b2945, JW2912[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
66.56 minutes |
MG1655: 3088369..3089076 | ||
|
NC_012967: 2976098..2976805 | ||||
|
W3110 |
|
W3110: 3089003..3089710 | ||
|
NC_012759: 2975517..2976224 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
E208K |
Nonsynonomous mutation |
This is a SNP in E. coli K-12 Strain DH10B | ||||
|
ΔendA (Keio:JW2912) |
deletion |
deletion | |||||
|
endA1 | |||||||
|
endA2 | |||||||
|
endA101 | |||||||
|
endA5 | |||||||
|
endA3 | |||||||
|
endA4 | |||||||
|
endA6(del-ins)::kan | |||||||
|
endA7(del-ins)::Cm | |||||||
|
endA8(del:Frt:Tc)::Tc | |||||||
|
endA9(del-ins)::FRT | |||||||
|
ΔendA720::kan |
| ||||||
| edit table |
Notes
EndA is an enzyme in many proteobacteria. One function of the enzyme is cleaving unspecific internal sites at both RNA and DNA.[6] Cultures of mutant endA result in large amounts of chromosmal and plasmid DNA, which does not appear in the wild type allele. EndA is responsible for DNA and plasmid DNA decomposition [7].
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2912 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTACCGTTATTTGTCTATTGC Primer 2:CCGCTCTTTCGCGCCTGGCAAGC | |
|
Linked marker |
est. P1 cotransduction: 91% [9] | ||
|
Linked marker |
est. P1 cotransduction: 58% [9] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Durfee T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J Bacteriol 190: 2597-606 PubMed EcoliWiki page
- ↑ 3.0 3.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Cherepanov PP & Wackernagel W (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158: 9-14 PubMed EcoliWiki page
- ↑ Altermark B et al. (2007) Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae. FEBS J 274: 252-63 PubMed EcoliWiki page
- ↑ Lin JJ (1992) Endonuclease A degrades chromosomal and plasmid DNA of Escherichia coli present in most preparations of single stranded DNA from phagemids. Proc Natl Sci Counc Repub China B 16: 1-5 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
