PortEco logo

endA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

endA

Mnemonic

Endonuclease

Synonyms

ECK2940, b2945, JW2912[1], JW2912

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

66.56 minutes 

MG1655: 3088369..3089076


REL606

NC_012967: 2976098..2976805


BW2952

NC_012759: 2975517..2976224


W3110

 

W3110: 3089003..3089710


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Strain DH10B

E208K

Nonsynonomous mutation

PMID:18245285[2]

ASAP

This is a SNP in E. coli K-12 Strain DH10B

endA(del) (Keio:JW2912)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC10253[4]

endA1

CGSC:5430

endA2

CGSC:5609

endA101

CGSC:8416

endA5

CGSC:10668

endA3

CGSC:14266

endA4

CGSC:16230

endA6(del-ins)::kan

CGSC:35763

endA7(del-ins)::Cm

CGSC:35768

endA8(del:Frt:Tc)::Tc

PMID:7789817[5]

CGSC:59095

endA9(del-ins)::FRT

CGSC:64683

endA720(del)::kan

PMID:16738554[3]

CGSC:100710


Notes

EndA is an enzyme in many proteobacteria. One function of the enzyme is cleaving unspecific internal sites at both RNA and DNA.[6] Cultures of mutant endA result in large amounts of chromosmal and plasmid DNA, which does not appear in the wild type allele. EndA is responsible for DNA and plasmid DNA decomposition [7].


Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2912

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCTACCGTTATTTGTCTATTGC

Primer 2:CCGCTCTTTCGCGCCTGGCAAGC

23G4S

Kohara Phage

Genobase

PMID:3038334[9]

12C6

Kohara Phage

Genobase

PMID:3038334[9]

speA210::Tn10

Linked marker

CAG12168 = CGSC7431[4]

est. P1 cotransduction: 91% [10]
Synonyms:zgd-210::Tn10, zgf-210::Tn10

nupG511::Tn10

Linked marker

CAG18472 = CGSC7433[4]

est. P1 cotransduction: 58% [10]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11336

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11336

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001307

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:949092

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1312

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009661

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Durfee, T et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J. Bacteriol. 190 2597-606 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Cherepanov, PP & Wackernagel, W (1995) Gene disruption in Escherichia coli: TcR and KmR cassettes with the option of Flp-catalyzed excision of the antibiotic-resistance determinant. Gene 158 9-14 PubMed EcoliWiki page
  6. Altermark, B et al. (2007) Comparative studies of endonuclease I from cold-adapted Vibrio salmonicida and mesophilic Vibrio cholerae. FEBS J. 274 252-63 PubMed EcoliWiki page
  7. Lin, JJ (1992) Endonuclease A degrades chromosomal and plasmid DNA of Escherichia coli present in most preparations of single stranded DNA from phagemids. Proc. Natl. Sci. Counc. Repub. China B 16 1-5 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories