PortEco logo

fabR:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

fabR

Gene Synonym(s)

ECK3955, b3963, JW3935, yijC[1], yijC

Product Desc.

FabR transcriptional repressor[2]; FabR transcriptional dual regulator[3]

Transcriptional repressor of fabA and fabB[4]

Product Synonyms(s)

DNA-binding transcriptional repressor[1], B3963[2][1], FabR[2][1], YijC[2][1] , ECK3955, JW3935, yijC, b3963

Function from GO

Molecular Function

Biological Process

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): fabR[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]


TetR family.[4]



Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

fabR

Mnemonic

Fatty acid biosynthesis regulator

Synonyms

ECK3955, b3963, JW3935, yijC[1], yijC

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

89.64 minutes 

MG1655: 4159090..4159794


BW2952

NC_012759: 4048816..4049463


W3110

 

W3110: 3475614..3474910


DH10B

DH10B: 4258844..4259491


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔfabR (Keio:JW3935)

deletion

deletion

PMID:16738554

Shigen
CGSC10840[5]

ΔfabR751::kan

PMID:16738554

CGSC:100776

Strain BW2952

G125T

PMID:19376874

Relative to MG1655.

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3935

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCTTCATTCTCTGGTATAGTGC

Primer 2:CCtTCGTCCTTCACATTTCCCGG

4G11

Kohara Phage

Genobase

PMID:3038334

argE86::Tn10

Linked marker

CAG12185 = CGSC7471[5]

est. P1 cotransduction: 80% [6]

thiC39::Tn10

Linked marker

CAG18500 = CGSC7472[5]

est. P1 cotransduction: 24% [6]
Synonyms:thi-39::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11394

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11394

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001361

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948460

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1367

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012979

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

FabR

Synonyms

DNA-binding transcriptional repressor[1], B3963[2][1], FabR[2][1], YijC[2][1] , ECK3955, JW3935, yijC, b3963

Product description

FabR transcriptional repressor[2]; FabR transcriptional dual regulator[3]

Transcriptional repressor of fabA and fabB[4]

EC number (for enzymes)


Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0003700

transcription factor activity

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_01190

F

Seeded from EcoCyc (v14.0)

complete

GO:0003700

transcription factor activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR001647

F

Seeded from EcoCyc (v14.0)

complete

GO:0003700

transcription factor activity

PMID:11160901

IDA: Inferred from Direct Assay

F

Seeded from EcoCyc (v14.0)

complete

GO:0003700

transcription factor activity

PMID:11859088

IDA: Inferred from Direct Assay

F

Seeded from EcoCyc (v14.0)

complete

GO:0005737

cytoplasm

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_01190

C

Seeded from EcoCyc (v14.0)

complete

GO:0005737

cytoplasm

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0963

C

Seeded from EcoCyc (v14.0)

complete

GO:0005737

cytoplasm

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-0086

C

Seeded from EcoCyc (v14.0)

complete

GO:0006633

fatty acid biosynthetic process

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_01190

P

Seeded from EcoCyc (v14.0)

complete

GO:0006633

fatty acid biosynthetic process

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0275

P

Seeded from EcoCyc (v14.0)

complete

GO:0008610

lipid biosynthetic process

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0444

P

Seeded from EcoCyc (v14.0)

complete

GO:0016563

transcription activator activity

PMID:11859088

IDA: Inferred from Direct Assay

F

Seeded from EcoCyc (v14.0)

complete

GO:0016566

specific transcriptional repressor activity

PMID:11160901

IDA: Inferred from Direct Assay

F

Seeded from EcoCyc (v14.0)

complete

GO:0016566

specific transcriptional repressor activity

PMID:11859088

IDA: Inferred from Direct Assay

F

Seeded from EcoCyc (v14.0)

complete

GO:0032582

negative regulation of gene-specific transcription

PMID:11160901

IDA: Inferred from Direct Assay

P

Seeded from EcoCyc (v14.0)

complete

GO:0032582

negative regulation of gene-specific transcription

PMID:11859088

IDA: Inferred from Direct Assay

P

Seeded from EcoCyc (v14.0)

complete

GO:0045717

negative regulation of fatty acid biosynthetic process

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_01190

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MFILWYSASS TFGKDSDIVM GVRAQQKEKT RRSLVEAAFS QLSAERSFAS LSLREVAREA
GIAPTSFYRH FRDVDELGLT MVDESGLMLR QLMRQARQRI AKGGSVIRTS VSTFMEFIGN
NPNAFRLLLR ERSGTSAAFR AAVAREIQHF IAELADYLEL ENHMPRAFTE AQAEAMVTIV
FSAGAEALDV GVEQRRQLEE RLVLQLRMIS KGAYYWYRRE QEKTAIIPGN VKDE
Length

234

Mol. Wt

26.553 kDa

pI

9.3 (calculated)

Extinction coefficient

19,940 (calc based on 6 Y, 2 W, and 0 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

15..62

PF00440 Bacterial regulatory proteins, tetR family

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:145698338

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:948460

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012979

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0ACU5

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG11394

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11394

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:948460

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001361

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1367

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

23.345+/-0.16

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.063210227

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

713

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

244

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

703

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

fabR

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b3963 (EcoliWiki Page)

NCBI GEO profiles for fabR

microarray

GenExpDB:b3963 (EcoliWiki Page)

Summary of data for fabR from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (4158205..4158693) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ19; Well:G12[7]

Notes

Accessions Related to fabR Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11394

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1367

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3963

EcoGene

EcoGene:EG11394

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001361

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012979

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Shigella flexneri

YIJC

From SHIGELLACYC

E. coli O157

YIJC

From ECOO157CYC


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00440 Bacterial regulatory proteins, tetR family

Superfamily (EcoliWiki Page)

SUPERFAMILY:46689

EcoCyc

EcoCyc:EG11394

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11394

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001361

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1367

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012979

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed EcoliWiki page

Categories

[back to top]