Try the new EcoliHub and let us know what you'd like to see.
fabZ:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
fabZ |
|---|---|
| Gene Synonym(s) |
ECK0179, b0180, JW0175, sefA, yaeA, sabA, sfhC, sfhC21, sabA1, G465[1][2] |
| Product Desc. |
3R-hydroxymyristoyl acyl carrier protein (ACP) dehydratase[4] |
| Product Synonyms(s) |
(3R)-hydroxymyristol acyl carrier protein dehydratase[1], B0180[2][1], YaeA[2][1], SefA[2][1], FabZ[2][1] |
| Function from GO | |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): yaeT-hlpA-lpxD-fabZ-lpxAB-rnhB-dnaE[2], ecfK-skp-lpxD-fabZ-lpxAB-rnhB-dnaE, hlpA-lpxD-fabZ-lpxA[2], fabZ[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Binds TrxA (Kumar, 2004).[4]
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fabZ |
|---|---|
| Mnemonic |
Fatty acid biosynthesis |
| Synonyms |
ECK0179, b0180, JW0175, sefA, yaeA, sabA, sfhC, sfhC21, sabA1, G465[1][2] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
4.36 minutes |
MG1655: 202101..202556 | ||
|
NC_012967: 204943..205398 | ||||
|
W3110 |
|
W3110: 202101..202556 | ||
|
DH10B: 176205..176660 | ||||
|
NC_012759: 202100..202555 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
sfhC21 |
Other |
PMID:10048027 |
Suppressor of ftsH lethality | ||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0175 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCACTACTAACACTCATACTCT Primer 2:CCGGCCTCCCGGCTACGAGCACA | |
|
Linked marker |
est. P1 cotransduction: 8% [6] | ||
|
Linked marker |
est. P1 cotransduction: 31% [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
FabZ |
|---|---|
| Synonyms |
(3R)-hydroxymyristol acyl carrier protein dehydratase[1], B0180[2][1], YaeA[2][1], SefA[2][1], FabZ[2][1] |
| Product description |
3R-hydroxymyristoyl acyl carrier protein (ACP) dehydratase[4] |
| EC number (for enzymes) | |
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0016836 |
hydro-lyase activity |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010084 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0016829 |
lyase activity |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0456 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0009245 |
lipid A biosynthetic process |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0441 |
P |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0008610 |
lipid biosynthetic process |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0444 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0006633 |
fatty acid biosynthetic process |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010084 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0005737 |
cytoplasm |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR010084 |
C |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0006654 |
phosphatidic acid biosynthetic process |
P |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of FABZ-CPLX |
could be indirect | ||
|
Protein |
clpA |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
ffh |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
glnS |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
lon |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplA |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplC |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplD |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplE |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplF |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplI |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplJ |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplM |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplS |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rplV |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rpsA |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rpsC |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rpsD |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rpsE |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
tufA |
PMID:15690043 |
Experiment(s):EBI-887148 | |
|
Protein |
gfcD |
PMID:16606699 |
Experiment(s):EBI-1135815 | |
|
Protein |
yjdA |
PMID:16606699 |
Experiment(s):EBI-1135815 | |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
|
Cytoplasm |
PMID:8354462, PMID:7806516, PMID:8805534, PMID:8910376 |
| ||
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MTTNTHTLQI EEILELLPHR FPFLLVDRVL DFEEGRFLRA VKNVSVNEPF FQGHFPGKPI FPGVLILEAM AQATGILAFK SVGKLEPGEL YYFAGIDEAR FKRPVVPGDQ MIMEVTFEKT RRGLTRFKGV ALVDGKVVCE ATMMCARSRE A |
|---|---|
| Length |
151 |
| Mol. Wt |
17.032 kDa |
| pI |
7.2 (calculated) |
| Extinction coefficient |
2,980 - 3,230 (calc based on 2 Y, W, and 2 C residues) |
| edit table |
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for fabZ | |
|
microarray |
Summary of data for fabZ from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (201915..202180) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
Notes
Accessions Related to fabZ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
FABZ |
From SHIGELLACYC |
|
E. coli O157 |
FABZ |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 8.0 8.1 8.2 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
- ↑ Zaslaver A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat Methods 3: 623-8 PubMed EcoliWiki page
Categories
