Try the new EcoliHub and let us know what you'd like to see.
fdnI:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
fdnI |
|---|---|
| Gene Synonym(s) |
ECK1470, b1476, JW1472[1] |
| Product Desc. |
formate dehydrogenase N, γ subunit[2][3]; Component of trimer complex of formate dehydrogenase-N α, β and γ subunits[2][3]; formate dehydrogenase-N[2][3] Formate dehydrogenase-N, cytochrome subunit, anaerobic[4] |
| Product Synonyms(s) |
formate dehydrogenase-N, cytochrome B556 (gamma) subunit, nitrate-inducible[1], B1476[2][1], FdnI[2][1] |
| Function from GO |
Molecular Function Biological Process
Cellular Component |
| Knock-Out Phenotype | |
| Regulation/Expression | |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
fdnI |
|---|---|
| Mnemonic |
Formate dehydrogenase-N |
| Synonyms |
ECK1470, b1476, JW1472[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
33.39 minutes |
MG1655: 1549362..1550015 | ||
|
NC_012967: 1525488..1526141 | ||||
|
W3110 |
|
W3110: 1553052..1553705 | ||
|
DH10B: 1639957..1640610 | ||||
|
NC_012759: 1441421..1442074 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔfdnI (Keio:JW1472) |
deletion |
deletion |
PMID:16738554 | ||||
|
ΔfdnI769::kan |
PMID:16738554 |
| |||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1472 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCAGTAAGTCGAAAATGATTGT Primer 2:CCTATCCCTTCTTCACTCTCTTT | |
|
Linked marker |
est. P1 cotransduction: 62% [6] | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
FdnI |
|---|---|
| Synonyms |
formate dehydrogenase-N, cytochrome B556 (gamma) subunit, nitrate-inducible[1], B1476[2][1], FdnI[2][1] |
| Product description |
formate dehydrogenase N, γ subunit[2][3]; Component of trimer complex of formate dehydrogenase-N α, β and γ subunits[2][3]; formate dehydrogenase-N[2][3] Formate dehydrogenase-N, cytochrome subunit, anaerobic[4] |
| EC number (for enzymes) |
|
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0045333 |
cellular respiration |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006471 |
P |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0009326 |
formate dehydrogenase complex |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006471 |
C |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0008863 |
formate dehydrogenase activity |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006471 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0006810 |
transport |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0005506 |
iron ion binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0008863 |
formate dehydrogenase activity |
PMID:11752799 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0009055 |
electron carrier activity |
PMID:1099094 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0009061 |
anaerobic respiration |
PMID:1099093 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0009326 |
formate dehydrogenase complex |
PMID:11752799 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0016021 |
integral to membrane |
PMID:6755185 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0017004 |
cytochrome complex assembly |
PMID:1099093 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0045333 |
cellular respiration |
PMID:5996 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0009053 |
electron donor activity |
F |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
|
GO:0005886 |
plasma membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0997 |
C |
Seeded from EcoCyc [8] |
complete | |
|
GO:0016020 |
membrane |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016174 |
C |
Seeded from EcoCyc [8] |
complete | |
|
GO:0022900 |
electron transport chain |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0249 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0022904 |
respiratory electron transport chain |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR016174 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0046872 |
metal ion binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc [8] |
complete | |
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of trimer complex of formate dehydrogenase-N α, β and γ subunits |
could be indirect | ||
|
Protein |
Subunits of formate dehydrogenase-N |
could be indirect |
| |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
|
plasma membrane |
C-terminus localized in the cytoplasm with 4 predicted transmembrane domains |
Daley et al. (2005) [9] | ||
|
plasma membrane |
From EcoCyc[3] |
| ||
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MSKSKMIVRT KFIDRACHWT VVICFFLVAL SGISFFFPTL QWLTQTFGTP QMGRILHPFF GIAIFVALMF MFVRFVHHNI PDKKDIPWLL NIVEVLKGNE HKVADVGKYN AGQKMMFWSI MSMIFVLLVT GVIIWRPYFA QYFPMQVVRY SLLIHAAAGI ILIHAILIHM YMAFWVKGSI KGMIEGKVSR RWAKKHHPRW YREIEKAEAK KESEEGI |
|---|---|
| Length |
217 |
| Mol. Wt |
25.368 kDa |
| pI |
10.3 (calculated) |
| Extinction coefficient |
52,940 - 53,190 (calc based on 6 Y, 8 W, and 2 C residues) |
| edit table |
Domains/Motifs/Modification Sites
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for fdnI | |
|
microarray |
Summary of data for fdnI from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Accessions Related to fdnI Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
FDNI |
From SHIGELLACYC |
|
E. coli O157 |
FDNI |
From ECOO157CYC |
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 8.0 8.1 8.2 8.3 8.4 8.5 8.6 8.7 8.8 8.9 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
- ↑ Daley DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308: 1321-3 PubMed EcoliWiki page
Categories

