Try the new EcoliHub and let us know what you'd like to see.
galK:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
galK |
|---|---|
| Mnemonic |
Galactose |
| Synonyms |
ECK0746, b0757, JW0740, galA[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
16.99 minutes |
MG1655: 789202..788054 | ||
|
NC_012967: 770608..769460 | ||||
|
W3110 |
|
W3110: 790401..789253 | ||
|
DH10B: 843130..840646 | ||||
|
NC_012759: 691022..692170 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔgalK (Keio:JW0740) |
deletion |
deletion | |||||
|
At position 850 in Plus orientation, does not contain plasmid pKD46. | |||||||
|
ΔgalK2 |
E coli bacteria was treated with UV radiation to induce mutation in galactose pathway [5]/> |
Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. [6]/> | |||||
|
galK2(Oc) |
ochre (UAA) mutation | ||||||
|
galK35 | |||||||
|
galK30 | |||||||
|
galK16 | |||||||
|
galK42(Am) |
amber (UAG) mutation | ||||||
|
galK48 | |||||||
|
galK8 | |||||||
|
galK0 | |||||||
|
galK900 | |||||||
|
galK24 | |||||||
|
galK62 | |||||||
|
ΔgalK729::kan |
| ||||||
| edit table |
Notes
Notice: no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0740 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTCTGAAAGAAAAAACACA Primer 2:CCGCACTGTCCTGCTCCTTGTGA | |
|
Linked marker |
est. P1 cotransduction: 75% [9] | ||
|
zbh-29::Tn10 |
Linked marker |
est. P1 cotransduction: 27% [9] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Glasner JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res 31: 147-51 PubMed EcoliWiki page
- ↑ 5.0 5.1 Morse ML et al. (1956) Transduction in Escherichia Coli K-12. Genetics 41: 142-56 PubMed EcoliWiki page
- ↑ 6.0 6.1 KURAHASHI K (1957) Enzyme formation in galactose-negative mutants of Escherichia coli. Science 125: 114-6 PubMed EcoliWiki page
- ↑ Oller AR et al. (1993) The Escherichia coli galK2 papillation assay: its specificity and application to seven newly isolated mutator strains. Mutat Res 292: 175-85 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
