PortEco logo

gldA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

gldA

Mnemonic

Glycerol dehydrogenase

Synonyms

ECK3937, b3945, JW5556, f380[1][2]

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

89.14 minutes 

MG1655: 4137058..4135955


REL606

NC_012967: 4119142..4118039


BW2952

NC_012759: 4025624..4026727


W3110

 

W3110: 3497646..3498749


DH10B

DH10B: 4236755..4235652


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔgldA (Keio:JW5556)

deletion

deletion

PMID:16738554[3]

Shigen

M6

Q70H G1193C E291Q A310T D121A

Mutation (M6) was able to increase catalytic activity by 26-fold of glycerol dehydrogenase on racemic 1, 3-butadiol for the bioproduction of the pharmaceutical intermediate 4-hydroxy-2-butanone, table 5.

PMID:20585771[4]


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW5556

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCGACCGCATTATTCAATCACC

Primer 2:CCTTCCCACTCTTGCAGGAAACG

6D8

Kohara Phage

Genobase

PMID:3038334[6]

zih-35::Tn10

Linked marker

CAG18495 = CGSC7467[7]

est. P1 cotransduction: 1% [8]

pflD501::Tn10

Linked marker

CAG18477 = CGSC7470[7]

est. P1 cotransduction: 78% [8]
Synonyms:zij-501::Tn10 nnnCAG18477 also carries metF79(Am) (CGSC).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11904

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11904

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001833

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948440

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1849

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0012912

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. Zhang, H et al. (2010) Engineering of glycerol dehydrogenase for improved activity towards 1, 3-butanediol. Appl. Microbiol. Biotechnol. 88 117-24 PubMed EcoliWiki page
  5. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  6. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  7. 7.0 7.1 CGSC: The Coli Genetics Stock Center
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories