PortEco logo

glmM:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

glmM

Mnemonic

Glucosamine

Synonyms

ECK3165, b3176, JW3143, mrsA, yhbF[1], yhbF

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

71.57 minutes 

MG1655: 3322092..3320755


REL606

NC_012967: 3259304..3257967


BW2952

NC_012759: 3207903..3209240


W3110

 

W3110: 3323925..3322588


DH10B

DH10B: 3419837..3418500


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3320758

Edman degradation

PMID:8550580[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔglmM (Keio:JW3143)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC10388[4]

glmMS100A

S100A

2% of wild-type activity

seeded from UniProt:P31120

glmMS100T

S100T

20-fold increase in the non- specific phosphoglucomutase activity towards glucose-phosphate substrates (non aminated)

seeded from UniProt:P31120

glmMS102A

S102A

Loss of activity in the absence or presence of glucosamine-1,6-diP

seeded from UniProt:P31120

ΔglmM784::kan

PMID:16738554[3]

CGSC:101152


Notes

The Keio collection[3] lists a deletion of glmM. The insertion in this strain is a duplication of the glmM region.[5]


Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3143

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAGTAATCGTAAATATTTCGG

Primer 2:CCAACGGCTTTTACTGCATCGGC

E4G11S

Kohara Phage

Genobase

PMID:3038334[7]

18H7

Kohara Phage

Genobase

PMID:3038334[7]

14F11

Kohara Phage

Genobase

PMID:3038334[7]

aer-3075::Tn10

Linked marker

CAG12152 = CGSC7438[4]

est. P1 cotransduction: % [8]
Synonyms:zgh-3075::Tn10, zgj-3075::Tn10

sfsB203::Tn10

Linked marker

CAG12072 = CGSC7440[4]

est. P1 cotransduction: 70% [8]
Synonyms:zgj-203::Tn10, zha-203::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11553

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11553

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001506

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947692

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1514

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010439

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Mengin-Lecreulx, D & van Heijenoort, J (1996) Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli. J. Biol. Chem. 271 32-9 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 7.2 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories