PortEco logo

glmM:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

glmM

Gene Synonym(s)

ECK3165, b3176, JW3143, mrsA, yhbF[1], yhbF

Product Desc.

Phosphoglucosamine mutase; UDP-GlcNAc pathway, peptidoglycan, lipopolysaccharide synthesis; mRNA stability effects[2]

Product Synonyms(s)

phosphoglucosamine mutase[1], B3176[3][1], YhbF[3][1], GlmM[3][1], MrsA[3][1] , ECK3165, JW3143, mrsA, yhbF, b3176

Function from GO
Knock-Out Phenotype
Regulation/Expression

transcription unit(s): glmM[3]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]


Autophosphorylated enzyme (at Ser-102) is active form. glmM is an essential gene. Binds TrxA (Kumar, 2004).[2]



Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

glmM

Mnemonic

Glucosamine

Synonyms

ECK3165, b3176, JW3143, mrsA, yhbF[1], yhbF

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

71.57 minutes 

MG1655: 3322092..3320755


REL606

NC_012967: 3259304..3257967


BW2952

NC_012759: 3207903..3209240


W3110

 

W3110: 3323925..3322588


DH10B

DH10B: 3419837..3418500


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3320758

Edman degradation

PMID:8550580


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔglmM (Keio:JW3143)

deletion

deletion

PMID:16738554

Shigen
CGSC10388[4]

glmMS100A

S100A

2% of wild-type activity

seeded from UniProt:P31120

glmMS100T

S100T

20-fold increase in the non- specific phosphoglucomutase activity towards glucose-phosphate substrates (non aminated)

seeded from UniProt:P31120

glmMS102A

S102A

Loss of activity in the absence or presence of glucosamine-1,6-diP

seeded from UniProt:P31120

ΔglmM784::kan

PMID:16738554

CGSC:101152


Notes

The Keio collection[5] lists a deletion of glmM. The insertion in this strain is a duplication of the glmM region.[6]


Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3143

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAGTAATCGTAAATATTTCGG

Primer 2:CCAACGGCTTTTACTGCATCGGC

E4G11S

Kohara Phage

Genobase

PMID:3038334

18H7

Kohara Phage

Genobase

PMID:3038334

14F11

Kohara Phage

Genobase

PMID:3038334

aer-3075::Tn10

Linked marker

CAG12152 = CGSC7438[4]

est. P1 cotransduction: % [7]
Synonyms:zgh-3075::Tn10, zgj-3075::Tn10

sfsB203::Tn10

Linked marker

CAG12072 = CGSC7440[4]

est. P1 cotransduction: 70% [7]
Synonyms:zgj-203::Tn10, zha-203::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11553

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11553

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001506

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947692

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1514

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010439

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

GlmM

Synonyms

phosphoglucosamine mutase[1], B3176[3][1], YhbF[3][1], GlmM[3][1], MrsA[3][1] , ECK3165, JW3143, mrsA, yhbF, b3176

Product description

Phosphoglucosamine mutase; UDP-GlcNAc pathway, peptidoglycan, lipopolysaccharide synthesis; mRNA stability effects[2]

EC number (for enzymes)

Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0000287

magnesium ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR006352

F

Seeded from EcoCyc (v14.0)

complete

GO:0000287

magnesium ion binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016066

F

Seeded from EcoCyc (v14.0)

complete

GO:0000287

magnesium ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0460

F

Seeded from EcoCyc (v14.0)

complete

GO:0008966

phosphoglucosamine mutase activity

GOA:hamap
GO_REF:0000020

IEA: Inferred from Electronic Annotation

HAMAP:MF_01554

F

Seeded from EcoCyc (v14.0)

complete

GO:0008966

phosphoglucosamine mutase activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR006352

F

Seeded from EcoCyc (v14.0)

complete

GO:0008966

phosphoglucosamine mutase activity

GOA:spec
GO_REF:0000003

IEA: Inferred from Electronic Annotation

EC:5.4.2.10

F

Seeded from EcoCyc (v14.0)

complete

GO:0046872

metal ion binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0479

F

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

murC

PMID:15690043

Experiment(s):EBI-888671

Protein

recA

PMID:15690043

Experiment(s):EBI-888671

Protein

tufA

PMID:15690043

Experiment(s):EBI-888671

Protein

nusG

PMID:15690043

Experiment(s):EBI-893878

Protein

rplK

PMID:15690043

Experiment(s):EBI-893878

Protein

rplL

PMID:15690043

Experiment(s):EBI-893878

Protein

rplM

PMID:15690043

Experiment(s):EBI-893878

Protein

rplV

PMID:15690043

Experiment(s):EBI-893878

Protein

rpsB

PMID:15690043

Experiment(s):EBI-893878

Protein

rpsE

PMID:15690043

Experiment(s):EBI-893878

Protein

rpsJ

PMID:15690043

Experiment(s):EBI-893878

Protein

mscS

PMID:15690043

Experiment(s):EBI-893878

Protein

mscS

PMID:19402753

LCMS(ID Probability):99.0

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MSNRKYFGTD GIRGRVGDAP ITPDFVLKLG WAAGKVLARH GSRKIIIGKD TRISGYMLES
ALEAGLAAAG LSALFTGPMP TPAVAYLTRT FRAEAGIVIS ASHNPFYDNG IKFFSIDGTK
LPDAVEEAIE AEMEKEISCV DSAELGKASR IVDAAGRYIE FCKATFPNEL SLSELKIVVD
CANGATYHIA PNVLRELGAN VIAIGCEPNG VNINAEVGAT DVRALQARVL AEKADLGIAF
DGDGDRVIMV DHEGNKVDGD QIMYIIAREG LRQGQLRGGA VGTLMSNMGL ELALKQLGIP
FARAKVGDRY VLEKMQEKGW RIGAENSGHV ILLDKTTTGD GIVAGLQVLA AMARNHMSLH
DLCSGMKMFP QILVNVRYTA GSGDPLEHES VKAVTAEVEA ALGNRGRVLL RKSGTEPLIR
VMVEGEDEAQ VTEFAHRIAD AVKAV
Length

445

Mol. Wt

47.544 kDa

pI

5.9 (calculated)

Extinction coefficient

24,410 - 25,035 (calc based on 9 Y, 2 W, and 5 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Initiator Methionine

1

Removed

UniProt:P31120

Modification Site

102

phosphorylation site at S102

probability greater than 75%

PMID:17938405

Domain

373..443

PF00408 Phosphoglucomutase/phosphomannomutase, C-terminal domain

PMID:19920124

Domain

4..138

PF02878 Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I

PMID:19920124

Domain

156..254

PF02879 Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II

PMID:19920124

Domain

258..369

PF02880 Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16131066

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:947692

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010439

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P31120

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG11553

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11553

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:947692

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001506

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1514

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MC4100

1.04E+03

molecules/cell

  • Medium: median data from rich and minimal media
  • Temperature (°C): 37
  • Doubling time (min): Growth Rate(min):
  • Growth phase: other:

emPAI

PMID:18304323

Protein

Ecoli K-12

146.558+/-2.554

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

Protein

E. coli K-12 MG1655

5713

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

1268

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

3253

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

glmM

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b3176 (EcoliWiki Page)

NCBI GEO profiles for glmM

microarray

GenExpDB:b3176 (EcoliWiki Page)

Summary of data for glmM from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

Notes

Accessions Related to glmM Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11553

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1514

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3176

EcoGene

EcoGene:EG11553

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001506

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010439

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Bos taurus

  • ENSBTAP00000000902 (score: 1.000; bootstrap: 51%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000004345 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Dictyostelium discoideum

  • DDB0204675 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0036298 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA10449-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Gallus gallus

  • ENSGALP00000025512 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Macaca mulatta

  • ENSMMUP00000016524 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Saccharomyces cerevisiae

  • YEL058W (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Schizosaccharomyces pombe

  • SPAC12961c (score: 1.000; bootstrap: 100%)
  • SPAC13C55c (score: 0.299)

From Inparanoid:20070104

Xenopus tropicalis

  • ENSXETP00000005021 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

MRSA

From SHIGELLACYC

E. coli O157

MRSA

From ECOO157CYC


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Panther (EcoliWiki Page)

PTHR22573:SF14

Superfamily (EcoliWiki Page)

SUPERFAMILY:53738

Superfamily (EcoliWiki Page)

SUPERFAMILY:53738

Superfamily (EcoliWiki Page)

SUPERFAMILY:53738

Superfamily (EcoliWiki Page)

SUPERFAMILY:55957

Pfam (EcoliWiki Page)

PF00408 Phosphoglucomutase/phosphomannomutase, C-terminal domain

Pfam (EcoliWiki Page)

PF02878 Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I

Pfam (EcoliWiki Page)

PF02879 Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II

Pfam (EcoliWiki Page)

PF02880 Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III

EcoCyc

EcoCyc:EG11553

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11553

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001506

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1514

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0010439

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  3. 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  6. Yamamoto, N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol. Syst. Biol. 5 335 PubMed EcoliWiki page
  7. 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories

[back to top]