PortEco logo

gsk:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

gsk

Mnemonic

Guanosine kinase

Synonyms

ECK0471, b0477, JW0466[1], JW0466

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

10.76 minutes 

MG1655: 499349..500653


REL606

NC_012967: 472192..473496


BW2952

NC_012759: 402108..403412


W3110

 

W3110: 499349..500653


DH10B

DH10B: 438680..439984


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

499349

Edman degradation

PMID:7721718[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

gsk(del) (Keio:JW0466)

deletion

deletion

PMID:16738554[3]

Shigen

CGSC8618[4]

gsk-3055::Tn10

Insertion at 500,025 bp in MG1655 (NC_000913)

adapted from Nichols et al.[5]

CAG12154 = CGSC7341[4]

Synonyms: zbb-30-55::TnlO, zba-3055::Tn10

gsk-11

CGSC:7467

gsk-3055::Tn10

PMID:2540407[6] PMID:9829956[7]

CGSC:39377

gsk-759(del)::kan

PMID:16738554[3]

CGSC:101264


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0466

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCAAATTTCCCGGTAAACGTAA

Primer 2:CCACGATCCCAGTAAGACTCTTC

12H5

Kohara Phage

Genobase

PMID:3038334[9]

4B10

Kohara Phage

Genobase

PMID:3038334[9]

zaj-3054::Tn10

Linked marker

CAG12017 = CGSC7339[4]

est. P1 cotransduction: 18% [5]
Synonyms:zba-3054::Tn10

purK79::Tn10

Linked marker

CAG12171 = CGSC7342[4]

est. P1 cotransduction: 8% [5]
Synonyms:purE79::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11102

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11102

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001090

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946584

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1094

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001655

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Harlow, KW et al. (1995) Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli. J. Bacteriol. 177 2236-40 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 5.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  6. Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed EcoliWiki page
  7. Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories