Try the new EcoliHub and let us know what you'd like to see.
gyrA:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
gyrA |
|---|---|
| Mnemonic |
Gyrase |
| Synonyms |
ECK2223, b2231, JW2225, hisW, nalA, parD, nfxA, norA[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
50.32 minutes |
MG1655: 2337442..2334815 | ||
|
NC_012967: 2286120..2283493 | ||||
|
W3110 |
|
W3110: 2344090..2341463 | ||
|
DH10B: 2428430..2425803 | ||||
|
NC_012759: 2220620..2223247 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
gyrAA67S |
A67S |
(in PPA-10; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAG81C |
G81C |
(in NAL-97; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAD678E |
D678E |
(in strain: 227) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAI798IMMI |
I798IMMI |
(in KL-16; quinolone- resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAA828S |
A828S |
(in strain: 227) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAS83A |
S83A |
Resistant to fluoroquinolones |
seeded from UniProt:P0AES4 | ||||
|
gyrAQ106R |
Q106R |
Resistant to fluoroquinolones |
seeded from UniProt:P0AES4 | ||||
|
gyrAS83W |
S83W |
(in PPA-18 and strain 227; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAA84P |
A84P |
(in PPA-05; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAD87N |
D87N |
(in NAL-113 and KL-16; quinolone- resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAQ106H |
Q106H |
(in NAL-89; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAD87V |
D87V |
(in strain: 202; quinolone- resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrAS83L |
S83L |
(in NAL-51, NAL-112, NAL-118 and NAL-119; quinolone-resistant) |
Strain variation; seeded from UniProt:P0AES4 | ||||
|
gyrA98(NalR) |
nalidixic acid resistant | ||||||
|
gyrA20(NalR) |
nalidixic acid resistant | ||||||
|
gyrA12(NalR) |
nalidixic acid resistant | ||||||
|
gyrA26(NalR) |
nalidixic acid resistant | ||||||
|
gyrA39(NalR) |
nalidixic acid resistant | ||||||
|
gyrA96(NalR) |
nalidixic acid resistant | ||||||
|
gyrA91(NalR) |
nalidixic acid resistant | ||||||
|
gyrA93(NalR) |
nalidixic acid resistant | ||||||
|
gyrA216(NalR) |
nalidixic acid resistant | ||||||
|
gyrA220(NalR) |
nalidixic acid resistant | ||||||
|
gyrA218(NalR) |
nalidixic acid resistant | ||||||
|
gyrA13(NalR) |
nalidixic acid resistant | ||||||
|
gyrA19(NalR) |
nalidixic acid resistant | ||||||
|
gyrA111(NalR) |
nalidixic acid resistant | ||||||
|
gyrA261(NalR) |
nalidixic acid resistant | ||||||
|
gyrA90(NalR) |
nalidixic acid resistant | ||||||
|
gyrA99(NalR) |
nalidixic acid resistant | ||||||
|
gyrA49 | |||||||
|
gyrA217(NalR) |
nalidixic acid resistant | ||||||
|
gyrA223(NalR) |
nalidixic acid resistant | ||||||
|
gyrA219(NalR) |
nalidixic acid resistant | ||||||
|
gyrA271(NalR) |
nalidixic acid resistant | ||||||
|
gyrA260(NalR) |
nalidixic acid resistant | ||||||
|
gyrA270(NalR) |
nalidixic acid resistant | ||||||
|
[gyrA43](ts) |
temperature sensitive | ||||||
|
gyrA25(NalR) |
nalidixic acid resistant | ||||||
|
gyrA21(NalR) |
nalidixic acid resistant | ||||||
|
gyrA222(NalR) |
nalidixic acid resistant | ||||||
|
gyrA29(NalR) |
nalidixic acid resistant | ||||||
|
gyrA17(NalR) |
nalidixic acid resistant | ||||||
|
gyrA42(ts) |
temperature sensitive | ||||||
|
gyrA283(NalR) |
nalidixic acid resistant | ||||||
|
gyrA44(ts) |
temperature sensitive | ||||||
|
gyrA37(NalR) |
nalidixic acid resistant | ||||||
|
gyrA329(NalR) |
nalidixic acid resistant | ||||||
|
gyrA284(NalR) |
nalidixic acid resistant | ||||||
|
gyrA900 | |||||||
|
gyrA586(NalR) |
nalidixic acid resistant |
| |||||
| edit table |
Notes
A Latin American study found that the gyrA single-point mutation has caused E. coli to become resistant to Fluoroquinolones, or antimicrobial drugs. This has resulted in an increase in the number of urinary tract infections. [2]
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2225 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGACCTTGCGAGAGAAAT Primer 2:CCTTCTTCTTCTGGCTCGTCGTC | |
|
Linked marker |
est. P1 cotransduction: 59% [5] | ||
|
Linked marker |
est. P1 cotransduction: 76% [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Gales AC et al. (2000) Occurrence of single-point gyrA mutations among ciprofloxacin-susceptible Escherichia coli isolates causing urinary tract infections in Latin America. Diagn Microbiol Infect Dis 36: 61-4 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
