PortEco logo

gyrA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

gyrA

Mnemonic

Gyrase

Synonyms

ECK2223, b2231, JW2225, hisW, nalA, parD, nfxA, norA[1], norA

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

50.32 minutes 

MG1655: 2337442..2334815


REL606

NC_012967: 2286120..2283493


BW2952

NC_012759: 2220620..2223247


W3110

 

W3110: 2344090..2341463


DH10B

DH10B: 2428430..2425803


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2334818

Edman degradation

PMID:3029031[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

gyrAA67S

A67S

Resistant to

(in PPA-10; quinolone-resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAG81C

G81C

(in NAL-97; quinolone-resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAD678E

D678E

(in strain: 227)

Strain variation; seeded from UniProt:P0AES4

gyrAI798IMMI

I798IMMI

(in KL-16; quinolone- resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAA828S

A828S

(in strain: 227)

Strain variation; seeded from UniProt:P0AES4

gyrAS83A

S83A

Resistant to fluoroquinolones

seeded from UniProt:P0AES4

gyrAQ106R

Q106R

Resistant to fluoroquinolones

seeded from UniProt:P0AES4

gyrAS83W

S83W

(in PPA-18 and strain 227; quinolone-resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAA84P

A84P

(in PPA-05; quinolone-resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAD87N

GAC -> AAC at codon 87

D87N

Resistant to

(in NAL-113 and KL-16; quinolone- resistant)

resistant to 200 ug/ml nalidixic acid

Strain variation; seeded from UniProt:P0AES4

gyrAQ106H

Q106H

(in NAL-89; quinolone-resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAD87V

D87V

(in strain: 202; quinolone- resistant)

Strain variation; seeded from UniProt:P0AES4

gyrAS83L

S83L

(in NAL-51, NAL-112, NAL-118 and NAL-119; quinolone-resistant)

Strain variation; seeded from UniProt:P0AES4

gyrA98(NalR)

nalidixic acid resistant

CGSC:4735

gyrA20(NalR)

nalidixic acid resistant

CGSC:4693

gyrA12(NalR)

nalidixic acid resistant

CGSC:5833

gyrA26(NalR)

nalidixic acid resistant

CGSC:6591

gyrA39(NalR)

nalidixic acid resistant

CGSC:6657

gyrA96(NalR)

nalidixic acid resistant

CGSC:6781

gyrA91(NalR)

nalidixic acid resistant

CGSC:6799

gyrA93(NalR)

nalidixic acid resistant

CGSC:7183

gyrA216(NalR)

nalidixic acid resistant

CGSC:7227

gyrA220(NalR)

nalidixic acid resistant

CGSC:7261

gyrA218(NalR)

nalidixic acid resistant

CGSC:7270

gyrA13(NalR)

nalidixic acid resistant

CGSC:8316

gyrA19(NalR)

nalidixic acid resistant

CGSC:8423

gyrA111(NalR)

nalidixic acid resistant

CGSC:8506

gyrA261(NalR)

nalidixic acid resistant

CGSC:8753

gyrA90(NalR)

nalidixic acid resistant

CGSC:9163

gyrA99(NalR)

nalidixic acid resistant

CGSC:9220

gyrA49

CGSC:9554

gyrA217(NalR)

nalidixic acid resistant

CGSC:9588

gyrA223(NalR)

nalidixic acid resistant

CGSC:9628

gyrA219(NalR)

nalidixic acid resistant

CGSC:9719

gyrA271(NalR)

nalidixic acid resistant

CGSC:10266

gyrA260(NalR)

nalidixic acid resistant

CGSC:10312

gyrA270(NalR)

nalidixic acid resistant

CGSC:10450

[gyrA43](ts)

temperature sensitive

CGSC:10853

gyrA25(NalR)

nalidixic acid resistant

CGSC:10898

gyrA21(NalR)

nalidixic acid resistant

CGSC:11844

gyrA222(NalR)

nalidixic acid resistant

CGSC:12272

gyrA29(NalR)

nalidixic acid resistant

CGSC:12928

gyrA17(NalR)

nalidixic acid resistant

CGSC:14039

gyrA42(ts)

temperature sensitive

CGSC:17046

gyrA283(NalR)

nalidixic acid resistant

CGSC:17056

gyrA44(ts)

temperature sensitive

CGSC:17109

gyrA37(NalR)

nalidixic acid resistant

CGSC:19366

gyrA329(NalR)

nalidixic acid resistant

CGSC:23665

gyrA284(NalR)

nalidixic acid resistant

CGSC:26543

gyrA900

CGSC:73380

gyrA586(NalR)

nalidixic acid resistant

CGSC:90278

gyrA(Am) from OV6

Growth Phenotype

at 42C the separation of DNA into nucleoids and division localization are both disturbed but cells have continued growth and DNA replication production of cells, and normal sized cells are all produced at 42C

PMID:330757[3]

gyrA43(TS)

Resistant to

Resistant to Nalidixic Acid at the permissive temperature 32 C.

PMID:3025879[4]

Strain: KRF949

Parental Strain: CGSC KNK43


CGSC of allele, not strain.

gyrA43

Resistant to

Resistant to Triazolealanine.

PMID:3025879[4]

Strain: KRE449

Parental:CGSC KNK453

Results on table 4.

nalA mutation in MH5

Resistant to

resistance to nalidixic acid

PMID:4895844[5]

similar strain: MH7 resistant at 40ug nal per ml, sensitive at 60ug nal per ml

gyrAR S83L

S83L

Resistant to

Quinolone Resistance

PMID:8524852[6]

The mutation conferred an increase in resistance toward Quinolones. See figure 1B. chEBI:23765

gyrAnal-112

TCG-->TTG

S83L

Resistant to

Resistant to nalidixic acid

PMID:2168148[7]

Parental strain: KL16

Results found in Table 1. Mutation and phenotype identical in strains gyrAnal-118, gyrAnal-119, and gyrAnal-51.

gyrAppa-18

TCG-->TGG

S83W

Resistant to

Resistant to pipemidic acid.

PMID:2168148[7]

Parental strain: KL16

Results found in Table 1.

gyrAnal-113

GAC-->AAC

D87N

Resistant to

Resistant to nalidixic acid

PMID:2168148[7]

Parental strain: KL16

Results found in Table 1

gyrAnal-97

GGT-->TGT

G81C

Resistant to

Resistant to nalidixic acid.

PMID:2168148[7]

Parental strain: KL16

Results found in Table 1.

gyrAppa-5

GCG-->CCG

A84P

Resistant to

Resistant to pipemidic acid.

PMID 2168148

Parental strain: KL16

Results found in Table 1.

gyrAppa-10

GGC-->TCC

A67S

Resistant to

Resistant to pipemidic acid.

PMID:2168148[7]

Parental strain: KL16

Results found in Table 1.

gyrAnal-89

CAG-->CAT

Q106H

Resistant to

Resistant to nalidixic acid.

PMID:2168148[7]

Parental strain: KL16

Results found in Table 1.

Notes

A Latin American study found that the gyrA single-point mutation has caused E. coli to become resistant to Fluoroquinolones, or antimicrobial drugs. This has resulted in an increase in the number of urinary tract infections. [8]


Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2225

Plasmid clone

Shigen

PMID:16769691[9]

Status:Clone OK

Primer 1:GCCAGCGACCTTGCGAGAGAAAT

Primer 2:CCTTCTTCTTCTGGCTCGTCGTC

E13A5

Kohara Phage

Genobase

PMID:3038334[10]

2E8

Kohara Phage

Genobase

PMID:3038334[10]

atoS298::Tn10

Linked marker

CAG12177 gyrA+ = CGSC7525[11]

est. P1 cotransduction: 59% [12]
Synonyms:zeh-298::Tn10, zej-298::Tn10 nnnThe original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

zfa-723::Tn10

Linked marker

CAG12178 gyrA+ = CGSC7526[11]

est. P1 cotransduction: 76% [12]
Synonyms:zei-723::Tn10, zfa-723::Tn10 nnnThe original CAG12178 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10423

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10423

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000416

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:946614

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0418

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0007370

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Menzel, R & Gellert, M (1987) Fusions of the Escherichia coli gyrA and gyrB control regions to the galactokinase gene are inducible by coumermycin treatment. J. Bacteriol. 169 1272-8 PubMed EcoliWiki page
  3. Frank, S et al. (1977) Immunocycte stimulation in vitro by nontoxic bacterial lipopolysaccharide derivatives. J. Immunol. 119 855-60 PubMed EcoliWiki page
  4. 4.0 4.1 Rudd, KE & Menzel, R (1987) his operons of Escherichia coli and Salmonella typhimurium are regulated by DNA supercoiling. Proc. Natl. Acad. Sci. U.S.A. 84 517-21 PubMed EcoliWiki page
  5. Hane, MW & Wood, TH (1969) Escherichia coli K-12 mutants resistant to nalidixic acid: genetic mapping and dominance studies. J. Bacteriol. 99 238-41 PubMed EcoliWiki page
  6. Khodursky, AB et al. (1995) Topoisomerase IV is a target of quinolones in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 92 11801-5 PubMed EcoliWiki page
  7. 7.0 7.1 7.2 7.3 7.4 7.5 Yoshida, H et al. (1990) Quinolone resistance-determining region in the DNA gyrase gyrA gene of Escherichia coli. Antimicrob. Agents Chemother. 34 1271-2 PubMed EcoliWiki page
  8. Gales, AC et al. (2000) Occurrence of single-point gyrA mutations among ciprofloxacin-susceptible Escherichia coli isolates causing urinary tract infections in Latin America. Diagn. Microbiol. Infect. Dis. 36 61-4 PubMed EcoliWiki page
  9. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  10. 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  11. 11.0 11.1 CGSC: The Coli Genetics Stock Center
  12. 12.0 12.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories