Try the new EcoliHub and let us know what you'd like to see.
ileS:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ileS |
|---|---|
| Mnemonic |
Isoleucine |
| Synonyms |
ECK0027, b0026, JW0024, ilvS[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.48 minutes |
MG1655: 22391..25207 | ||
|
NC_012967: 26463..29279 | ||||
|
W3110 |
|
W3110: 22391..25207 | ||
|
DH10B: 22391..25207 | ||||
|
NC_012759: 22391..25207 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ileSG94R |
G94R |
6000-fold increase in Km for isoleucine and 4-fold increase in Km for ATP, with no effect on activity |
seeded from UniProt:P00956 | ||||
|
ileST243R |
T243R |
Abolishes pretransfer editing |
seeded from UniProt:P00956 | ||||
|
ileST246A |
T246A |
Nearly the same editing activity as the wild-type |
seeded from UniProt:P00956 | ||||
|
ileST241A |
T241A |
Nearly the same editing activity as the wild-type |
seeded from UniProt:P00956 | ||||
|
ileST242A |
T242A |
Abolishes editing activity against valine, with little change in aminoacylation activity; when associated with A-250 |
seeded from UniProt:P00956 | ||||
|
ileST242P |
T242P |
Abolishes editing activity against valine, with little change in aminoacylation activity |
seeded from UniProt:P00956 | ||||
|
ileST243A |
T243A |
Abolishes editing activity against valine, with little change in aminoacylation activity |
seeded from UniProt:P00956 | ||||
|
ileSW421A |
W421A |
Abolishes translocation from the aminoacylation site to the editing site, without effect on aminoacylation activity and posttransfer editing; when associated with A-183 |
seeded from UniProt:P00956 | ||||
|
ileSN250A |
N250A |
Abolishes editing activity against valine, with little change in aminoacylation activity |
seeded from UniProt:P00956 | ||||
|
ileSH333A |
H333A |
Alters the specificity for hydrolysis of the aminoacyl tRNA ester, with no effect on pretransfer editing |
seeded from UniProt:P00956 | ||||
|
ileSD342A,N |
D342A,N |
Strong decrease in total editing and deacylation activities. Severely deficient in translocation from the aminoacylation site to the editing site |
seeded from UniProt:P00956 | ||||
|
ileSD342E |
D342E |
Reduces 2- to 3-fold the total editing activity and 2-fold the deacylation activity. Moderately reduces translocation from the aminoacylation site to the editing site |
seeded from UniProt:P00956 | ||||
|
ileSK183A |
K183A |
Abolishes translocation from the aminoacylation site to the editing site, without effect on aminoacylation activity and posttransfer editing; when associated with A-421 |
seeded from UniProt:P00956 | ||||
|
ileSC97S |
C97S |
No effect on activity |
seeded from UniProt:P00956 | ||||
|
ileSF594L |
F594L |
(in strain: PS102) |
Strain variation; seeded from UniProt:P00956 | ||||
|
ileSI102N |
I102N |
No significant effect on activity |
seeded from UniProt:P00956 | ||||
|
ileS1 |
| ||||||
| edit table |
Notes
The Keio collection[3] lists a deletion of ileS. The insertion in this strain is a duplication of the ileS region.[4] IleS is the only Ile-aminoacyl tRNA synthetase in the genome.
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0024 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTGACTATAAATCAACCCT Primer 2:CCGGCAAACTTACGTTTTTCACC | |
|
Linked marker |
est. P1 cotransduction: 44% [7] | ||
|
Linked marker |
est. P1 cotransduction: 71% [7] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Iaccarino M & Berg P (1971) Isoleucine auxotrophy as a consequence of a mutationally altered isoleucyl-transfer ribonucleic acid synthetase. J Bacteriol 105: 527-37 PubMed EcoliWiki page
- ↑ Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ Yamamoto N et al. (2009) Update on the Keio collection of Escherichia coli single-gene deletion mutants. Mol Syst Biol 5: 335 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
- ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
