PortEco logo

kch:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

kch

Mnemonic

Potassium (K+) channel

Synonyms

ECK1244, b1250, JW1242[1], JW1242

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

28.17 minutes 

MG1655: 1308293..1307040


REL606

NC_012967: 1307863..1306610


BW2952

NC_012759: 1197889..1199142


W3110

 

W3110: 1311983..1310730


DH10B

DH10B: 1349302..1348115


DH10B

DH10B: 1348870..1348649


DH10B

DH10B: 1348576..1348217


DH10B

DH10B: 1397689..1396986


DH10B

DH10B: 1349311..1348058


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δkch (Keio:JW1242)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC9121[3]

kchS411N

S411N

(in strain: ECOR 46)

Strain variation; seeded from UniProt:P31069

kchA415V

A415V

(in strain: ECOR 28)

Strain variation; seeded from UniProt:P31069

kchA5T

A5T

(in strain: ECOR 52 and ECOR 60)

Strain variation; seeded from UniProt:P31069

kchN13K

N13K

(in strain: ECOR 52 and ECOR 60)

Strain variation; seeded from UniProt:P31069

kchP223S

P223S

(in strain: ECOR 4)

Strain variation; seeded from UniProt:P31069

kchL405Q

L405Q

(in strain: ECOR 4, ECOR 16, ECOR 28, ECOR 31, ECOR 37, ECOR 46, ECOR 50, ECOR 52, ECOR 60 and ECOR 71)

Strain variation; seeded from UniProt:P31069

kchE406K

E406K

(in strain: ECOR 46)

Strain variation; seeded from UniProt:P31069

kchS414L

S414L

(in strain: ECOR 46)

Strain variation; seeded from UniProt:P31069

Δkch-758::kan

PMID:16738554[2]

CGSC:101600


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1242

Plasmid clone

Shigen

PMID:16769691[4]

Status:Clone OK

Primer 1:GCCAGTCACTGGGCTACATTCAA

Primer 2:CCTTTTTGCGCCGATTCTTTACT

14C4

Kohara Phage

Genobase

PMID:3038334[5]

oppC506::Tn10

Linked marker

CAG12169 = CGSC7369[3]

est. P1 cotransduction: 90% [6]
Synonyms:zch-506::Tn10, zci-506::Tn10

trpC83::Tn10

Linked marker

CAG18455 = CGSC7371[3]

est. P1 cotransduction: 69% [6]
Synonyms:trpB83::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11606

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11606

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001554

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945841

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1563

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004189

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  5. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories