PortEco logo

kch:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

kch

Gene Synonym(s)

ECK1244, b1250, JW1242[1], JW1242

Product Desc.

potassium VIC channel[2][3]

Voltage-gated potassium channel protein; overproduction increases the permeability of the cytoplamsic membrane to K+; not involved in K+ uptake; overproduction alters membrane composition; homotetrameric membrane protein[4]

Product Synonyms(s)

voltage-gated potassium channel[1], B1250[2][1], Kch[2][1] , ECK1244, JW1242, b1250

Function from GO
Knock-Out Phenotype
Regulation/Expression

transcription unit(s): kch[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]


Consistently co-purifies with the degradosome.[4]



Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

kch

Mnemonic

Potassium (K+) channel

Synonyms

ECK1244, b1250, JW1242[1], JW1242

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

28.17 minutes 

MG1655: 1308293..1307040


REL606

NC_012967: 1307863..1306610


BW2952

NC_012759: 1197889..1199142


W3110

 

W3110: 1311983..1310730


DH10B

DH10B: 1349302..1348115


DH10B

DH10B: 1348870..1348649


DH10B

DH10B: 1348576..1348217


DH10B

DH10B: 1397689..1396986


DH10B

DH10B: 1349311..1348058


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δkch (Keio:JW1242)

deletion

deletion

PMID:16738554

Shigen
CGSC9121[5]

kchS411N

S411N

(in strain: ECOR 46)

Strain variation; seeded from UniProt:P31069

kchA415V

A415V

(in strain: ECOR 28)

Strain variation; seeded from UniProt:P31069

kchA5T

A5T

(in strain: ECOR 52 and ECOR 60)

Strain variation; seeded from UniProt:P31069

kchN13K

N13K

(in strain: ECOR 52 and ECOR 60)

Strain variation; seeded from UniProt:P31069

kchP223S

P223S

(in strain: ECOR 4)

Strain variation; seeded from UniProt:P31069

kchL405Q

L405Q

(in strain: ECOR 4, ECOR 16, ECOR 28, ECOR 31, ECOR 37, ECOR 46, ECOR 50, ECOR 52, ECOR 60 and ECOR 71)

Strain variation; seeded from UniProt:P31069

kchE406K

E406K

(in strain: ECOR 46)

Strain variation; seeded from UniProt:P31069

kchS414L

S414L

(in strain: ECOR 46)

Strain variation; seeded from UniProt:P31069

Δkch-758::kan

PMID:16738554

CGSC:101600


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1242

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAGTCACTGGGCTACATTCAA

Primer 2:CCTTTTTGCGCCGATTCTTTACT

14C4

Kohara Phage

Genobase

PMID:3038334

oppC506::Tn10

Linked marker

CAG12169 = CGSC7369[5]

est. P1 cotransduction: 90% [6]
Synonyms:zch-506::Tn10, zci-506::Tn10

trpC83::Tn10

Linked marker

CAG18455 = CGSC7371[5]

est. P1 cotransduction: 69% [6]
Synonyms:trpB83::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11606

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11606

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001554

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945841

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1563

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004189

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

Kch

Synonyms

voltage-gated potassium channel[1], B1250[2][1], Kch[2][1] , ECK1244, JW1242, b1250

Product description

potassium VIC channel[2][3]

Voltage-gated potassium channel protein; overproduction increases the permeability of the cytoplamsic membrane to K+; not involved in K+ uptake; overproduction alters membrane composition; homotetrameric membrane protein[4]

EC number (for enzymes)


Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0003824

catalytic activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016040

F

Seeded from EcoCyc (v14.0)

complete

GO:0005488

binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016040

F

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0997

C

Seeded from EcoCyc (v14.0)

complete

GO:0005886

plasma membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-1003

C

Seeded from EcoCyc (v14.0)

complete

GO:0006813

potassium ion transport

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR003148

P

Seeded from EcoCyc (v14.0)

complete

GO:0008152

metabolic process

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR016040

P

Seeded from EcoCyc (v14.0)

complete

GO:0016020

membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0472

C

Seeded from EcoCyc (v14.0)

complete

GO:0016021

integral to membrane

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0812

C

Seeded from EcoCyc (v14.0)

complete

GO:0016021

integral to membrane

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-9909

C

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

iscA

PMID:19402753

MALDI(Z-score):23.648996

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

plasma membrane

C-terminus localized in the cytoplasm with 6 predicted transmembrane domains

Daley et al. (2005) [7]

plasma membrane

From EcoCyc[3]


Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MSHWATFKQT ATNLWVTLRH DILALAVFLN GLLIFKTIYG MSVNLLDIFH IKAFSELDLS
LLANAPLFML GVFLVLNSIG LLFRAKLAWA ISIILLLIAL IYTLHFYPWL KFSIGFCIFT
LVFLLILRKD FSHSSAAAGT IFAFISFTTL LFYSTYGALY LSEGFNPRIE SLMTAFYFSI
ETMSTVGYGD IVPVSESARL FTISVIISGI TVFATSMTSI FGPLIRGGFN KLVKGNNHTM
HRKDHFIVCG HSILAINTIL QLNQRGQNVT VISNLPEDDI KQLEQRLGDN ADVIPGDSND
SSVLKKAGID RCRAILALSD NDADNAFVVL SAKDMSSDVK TVLAVSDSKN LNKIKMVHPD
IILSPQLFGS EILARVLNGE EINNDMLVSM LLNSGHGIFS DNDELETKAD SKESAQK
Length

417

Mol. Wt

46.065 kDa

pI

6.6 (calculated)

Extinction coefficient

33,920 - 34,295 (calc based on 8 Y, 4 W, and 3 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

246..365

PF02254 TrkA-N domain

PMID:19920124

Domain

148..226

PF07885 Ion channel

PMID:19920124


tmhmm.php?gene=kch&show=pic&.jpg
Click the image to view raw output from TMHMM.

Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16129211

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945841

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004189

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P31069

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG11606

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11606

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945841

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001554

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1563

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

29.372+/-0.187

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.028731045

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

120

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

123

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

65

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

kch

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b1250 (EcoliWiki Page)

NCBI GEO profiles for kch

microarray

GenExpDB:b1250 (EcoliWiki Page)

Summary of data for kch from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (1308206..1308637) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ17; Well:F1[8]

Notes

Accessions Related to kch Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11606

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1563

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b1250

EcoGene

EcoGene:EG11606

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001554

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004189

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Anopheles gambiae

  • ENSANGP00000021317 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Bos taurus

  • ENSBTAP00000017701 (score: 1.000; bootstrap: 100%)
  • ENSBTAP00000038666 (score: 0.115)

From Inparanoid:20070104

Caenorhabditis briggsae

  • WBGene00033787 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Caenorhabditis elegans

  • WBGene00004830 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Canis familiaris

  • ENSCAFP00000022780 (score: 1.000; bootstrap: 100%)
  • ENSCAFP00000009342 (score: 0.554)
  • ENSCAFP00000015336 (score: 0.091)
  • ENSCAFP00000029217 (score: 0.085)

From Inparanoid:20070104

Drosophila melanogaster

  • FBgn0003429 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Drosophila pseudoobscura

  • GA10500-PA (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Monodelphis domestica

  • ENSMODP00000001142 (score: 1.000; bootstrap: 100%)
  • ENSMODP00000013713 (score: 0.258)

From Inparanoid:20070104

Shigella flexneri

KCH

From SHIGELLACYC

E. coli O157

KCH

From ECOO157CYC


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Superfamily (EcoliWiki Page)

SUPERFAMILY:51735

Panther (EcoliWiki Page)

PTHR11537:SF103

Superfamily (EcoliWiki Page)

SUPERFAMILY:81324

Pfam (EcoliWiki Page)

PF02254 TrkA-N domain

Pfam (EcoliWiki Page)

PF07885 Ion channel

EcoCyc

EcoCyc:EG11606

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11606

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001554

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1563

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004189

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Daley, DO et al. (2005) Global topology analysis of the Escherichia coli inner membrane proteome. Science 308 1321-3 PubMed EcoliWiki page
  8. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed EcoliWiki page

Categories

[back to top]