PortEco logo

lacI:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

lacI

Gene Synonym(s)

ECK0342, b0345, JW0336[1], JW0336

Product Desc.

LacI transcriptional repressor[2][3]

Transcriptional repressor of lac operon[4]

Product Synonyms(s)

DNA-binding transcriptional repressor[1], B0345[2][1], LacI[2][1], transcriptional repressor of the lac operon[2][1] , ECK0342, JW0336, b0345

Function from GO

Cellular Component

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): lacI[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]





Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

lacI

Mnemonic

Lactose

Synonyms

ECK0342, b0345, JW0336[1], JW0336

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

7.88 minutes 

MG1655: 366734..365652


REL606

NC_012967: 340066..338984


W3110

 

W3110: 366734..365652


DH10B

DH10B: 1386177..1385095


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

365652

Edman degradation

PMID:1107032
PMID:4554534
PMID:4557395
PMID:4571224


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

lacI(del) (Keio:JW0336)

deletion

deletion

PMID:16738554

Shigen

CGSC8528[5]

lacIY282D

Y282D

(in T41 mutant)

Strain variation; seeded from UniProt:P03023

lacIY17H

Y17H

Broadening of specificity

seeded from UniProt:P03023

lacIR22N

R22N

Recognizes an operator variant

seeded from UniProt:P03023

lacI3042::Tn10

Insertion at 365,945 bp in MG1655 (NC_000913)

adapted from Nichols et al.[6]

CAG18439 = CGSC7334[5]

Synonyms: lacI42::Tn10 nnnCAG18439 also carries lacZ118(0c) (CGSC).

lacI60

CGSC:5329

lacI22

CGSC:5462

lacI694(IS)

CGSC:7293

lacI203

CGSC:7410

lacI100

CGSC:9476

lacI4500::Tn10

CGSC:24666

lacI3098::Tn10kan

PMID:2540407

CGSC:38617

lacI3042::Tn10

PMID:2540407

CGSC:39001

lacI373

CGSC:74371

lacI50(Fs)

CGSC:83700

frameshift mutation

lacI785(del)::kan

PMID:16738554

CGSC:101634


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0336

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAAACCAGTAACGTTATACGA

Primer 2:CCCTGCCCGCTTTCCAGTCGGGA

10A6

Kohara Phage

Genobase

PMID:3038334

proA81::Tn10

Linked marker

CAG18447 = CGSC7330[5]

est. P1 cotransduction: % [6]

mhpC281::Tn10

Linked marker

CAG12080 = CGSC7333[5]

est. P1 cotransduction: 83% [6]
Synonyms:zah-281::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10525

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10525

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000518

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945007

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0520

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001189

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

LacI

Synonyms

DNA-binding transcriptional repressor[1], B0345[2][1], LacI[2][1], transcriptional repressor of the lac operon[2][1] , ECK0342, JW0336, b0345

Product description

LacI transcriptional repressor[2][3]

Transcriptional repressor of lac operon[4]

EC number (for enzymes)


Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0003677

DNA binding

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR010982

F

Seeded from EcoCyc (v14.0)

complete

GO:0003677

DNA binding

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0238

F

Seeded from EcoCyc (v14.0)

complete

GO:0003700

transcription factor activity

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000843

F

Seeded from EcoCyc (v14.0)

complete

GO:0005829

cytosol

PMID:16858726

IDA: Inferred from Direct Assay

C

Seeded from EcoCyc (v14.0)

complete

GO:0006350

transcription

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0804

P

Seeded from EcoCyc (v14.0)

complete

GO:0006355

regulation of transcription, DNA-dependent

GOA:interpro
GO_REF:0000002

IEA: Inferred from Electronic Annotation

InterPro:IPR000843

P

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

lacZ

PMID:16606699

Experiment(s):EBI-1136310

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

cytoplasm

From EcoCyc[3]


Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MKPVTLYDVA EYAGVSYQTV SRVVNQASHV SAKTREKVEA AMAELNYIPN RVAQQLAGKQ
SLLIGVATSS LALHAPSQIV AAIKSRADQL GASVVVSMVE RSGVEACKAA VHNLLAQRVS
GLIINYPLDD QDAIAVEAAC TNVPALFLDV SDQTPINSII FSHEDGTRLG VEHLVALGHQ
QIALLAGPLS SVSARLRLAG WHKYLTRNQI QPIAEREGDW SAMSGFQQTM QMLNEGIVPT
AMLVANDQMA LGAMRAITES GLRVGADISV VGYDDTEDSS CYIPPLTTIK QDFRLLGQTS
VDRLLQLSQG QAVKGNQLLP VSLVKRKTTL APNTQTASPR ALADSLMQLA RQVSRLESGQ
Length

360

Mol. Wt

38.589 kDa

pI

6.9 (calculated)

Extinction coefficient

22,920 - 23,295 (calc based on 8 Y, 2 W, and 3 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

5..50

PF00356 Bacterial regulatory proteins, lacI family

PMID:19920124

Domain

76..327

PF00532 family

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:49176012

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:945007

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001189

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P03023

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG10525

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10525

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:945007

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000518

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0520

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

10-8

M

  • Medium:

PMID:16591435

Protein

E. coli K-12 MG1655

265

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

129

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

177

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

lacI

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b0345 (EcoliWiki Page)

NCBI GEO profiles for lacI

microarray

EcoliGenExpDB:b0345 (EcoliWiki Page)

Summary of data for lacI from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (366635..366852) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ20; Well:H2[7]

Notes

Accessions Related to lacI Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10525

Escherichia coli str. K-12 substr. MG1655

EcoCyc (EcoliWiki Page)

EcoCyc:EG10525

EchoBASE

EchoBASE:EB0520

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

GenExpDB:b0345

EcoGene

EcoGene:EG10525

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000518

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001189

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Apis mellifera

  • ENSAPMP00000034998 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

E. coli O157

LACI

From ECOO157CYC

Notes

Families

[back to top]


See Help:Evolution_families for help entering or editing information in this section of EcoliWiki.

Database Accession Notes

Pfam (EcoliWiki Page)

PF00356 Bacterial regulatory proteins, lacI family

Pfam (EcoliWiki Page)

PF00532 family


Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 5.3 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed EcoliWiki page

Categories

[back to top]