PortEco logo

lacZ:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

lacZ

Mnemonic

Lactose

Synonyms

ECK0341, b0344, JW0335[1], JW0335

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

7.81 minutes 

MG1655: 365529..362455


REL606

NC_012967: 338861..335787


BW2952

NC_012759: 4175805..4179047


W3110

 

W3110: 365529..362455


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

362458

Edman degradation

PMID:97295[2]
PMID:97298[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

lacZD202F

D202F

Obliterates all binding and catalysis

seeded from UniProt:P00722

lacZD202E,N

D202E,N

Causes a significant decrease in binding affinity in the absence of monovalent cations or in the presence of potassium ions, but only a moderate decrease in the presence of sodium ions

seeded from UniProt:P00722

lacZW1000F,G,L,T

W1000F,G,L,T

Decreases affinity for substrate

seeded from UniProt:P00722

lacZF602A

F602A

Decreases the stability of the loop 794-804

seeded from UniProt:P00722

lacZG795A

G795A

It forces the apoenzyme to adopt the closed rather than the open conformation. Reduces the binding affinity

seeded from UniProt:P00722

lacZE798A,L

E798A,L

The catalytic efficiency is not increased, when the sodium concentration increases

seeded from UniProt:P00722

lacZE798D,Q

E798D,Q

Small increase of the catalytic efficiency, when the sodium concentration increases

seeded from UniProt:P00722

lacZH541E,F,N

H541E,F,N

Poorly reactive with galactosyl substrates. Less stable to heat than wild-type

seeded from UniProt:P00722

lacZE538Q

E538Q

10000-fold decrease in the beta- galactosidase activity

seeded from UniProt:P00722

lacZE462H

E462H

Slowly inactivates galactosidase activity by reducing the binding of magnesium. It increases binding specificity

seeded from UniProt:P00722

lacZH358D,F,L,N

H358D,F,L,N

Less stable to heat than wild-type. Causes significant destabilizations of the first transition state

seeded from UniProt:P00722

lacZH392E,F,K

H392E,F,K

Essentially inactive unless very rapid purification. Causes very large destabilizations of the transition state

seeded from UniProt:P00722

lacZ4

CGSC:4649

lacZ43(Fs)

CGSC:4545

frameshift mutation

lacZ53(Am)

CGSC:4692

amber (UAG) mutation

lacZ36

CGSC:5084

lacZ125(Am)

PMID:5327654[4]

CGSC:5303

amber (UAG) mutation

lacZ73

CGSC:5701

lacZ46

CGSC:5741

lacZ827(UGA)

CGSC:5781

opal (UGA) mutation

lacZ82(Am)

CGSC:5996

amber (UAG) mutation

lacZ39(del)

CGSC:6051

lacZ13(Oc)

CGSC:6357

ochre (UAA) mutation

lacZ90(Oc)

PMID:6790520[5] PMID:5327654[4]

CGSC:6678

ochre (UAA) mutation

lacZ625(Am)

PMID:5327654[4]

CGSC:6682

amber (UAG) mutation

lacZ118(Oc)

PMID:5327654[4] PMID:412841[6] PMID:4876923[7]

CGSC:6685

ochre (UAA) mutation

lacZ659(Oc)

PMID:5327654[4]

CGSC:6687

ochre (UAA) mutation

lacZ404(Oc)

PMID:5327654[4]

CGSC:6690

ochre (UAA) mutation

lacZ521(UGA)

PMID:4915862[8]

CGSC:6930

opal (UGA) mutation

lacZ813(UGA)

PMID:4915862[8]

CGSC:6935

opal (UGA) mutation

lacZ105(Am)

CGSC:7341

amber (UAG) mutation

lacZ178

CGSC:7401

lacZ281(Am)

CGSC:7951

amber (UAG) mutation

lacZ57(del)

CGSC:7985

lacZ62

CGSC:8000

lacZ608(Am)

PMID:5327654[4] PMID:4915862[8]

CGSC:8396

amber (UAG) mutation

lacZ84

CGSC:8606

lacZ75(Fs)

CGSC:8609

frameshift mutation

lacZ482(Am)

CGSC:8713

amber (UAG) mutation

lacZ58(del)(M15)

CGSC:8749

lacZ98::Tn10

CGSC:8864

lacZ545(Am)

CGSC:8947

amber (UAG) mutation

lacZ2286(Am)

CGSC:9797

amber (UAG) mutation

lacZ624(Am)

PMID:4915862[8]

CGSC:10716

amber (UAG) mutation

lacZ95(del)

CGSC:10738

lacZ114((delH))

CGSC:10830

lacZ55

CGSC:11758

lacZ2210(Am)

CGSC:11841

amber (UAG) mutation

lacZ332(Fs)

PMID:1092652[9]

CGSC:12130

lacZ4503(Am)

CGSC:12975

amber (UAG) mutation

lacZ49

CGSC:16030

lacZ56

CGSC:16066

lacZ131

CGSC:19612

lacZ2246

CGSC:19613

lacZ8(Am)

PMID:2141650[10]

CGSC:23460

amber (UAG) mutation

lacZ59

CGSC:26947

lacZ4502::Tn10

PMID:337110[11]

CGSC:59813

lacZ4787(del)(::rrnB-3)

PMID:10829079[12]

CGSC:64656

lacZ4796::Tn5

CGSC:76213

lacZ536(Am)

CGSC:83183

amber (UAG) mutation

lacZ571(Am)

PMID:2501784[13]

CGSC:83642

amber (UAG) mutation

lacZ8305::Mu cts62

PMID:1111215[14]

CGSC:84395

lacZ4525::Tn10kan

PMID:9139905[15]

CGSC:85232

lacZ572

PMID:2501784[13]

CGSC:89114

lacZ574

PMID:2501784[13]

CGSC:89115

lacZ573

PMID:2501784[13]

CGSC:89116

lacZ575

PMID:2501784[13]

CGSC:89118

lacZ576

PMID:2501784[13]

CGSC:89119

lacZ1125

PMID:4915862[8] PMID:5327654[4]

CGSC:89575


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0335

Plasmid clone

Shigen

PMID:16769691[16]

Status:Clone OK

Primer 1:GCCACCATGATTACGGATTCACT

Primer 2:CCTTTTTGACACCAGACCAACTG

10A6

Kohara Phage

Genobase

PMID:3038334[17]

proA81::Tn10

Linked marker

CAG18447 = CGSC7330[18]

est. P1 cotransduction: % [19]

lacI3042::Tn10

Linked marker

CAG18439 = CGSC7334[18]

est. P1 cotransduction: 87% [19]
Synonyms:lacI42::Tn10 nnnCAG18439 also carries lacZ118(0c) (CGSC).

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10527

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10527

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000520

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945006

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0522

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001183

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Fowler, AV & Zabin, I (1978) Amino acid sequence of beta-galactosidase. VIII. Sequence of the NH2-terminal segment, CNBr peptides 1 to 9, residues 1 to 377. J. Biol. Chem. 253 5505-9 PubMed EcoliWiki page
  3. Fowler, AV & Zabin, I (1978) Amino acid sequence of beta-galactosidase. XI. Peptide ordering procedures and the complete sequence. J. Biol. Chem. 253 5521-5 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 4.3 4.4 4.5 4.6 4.7 Newton, WA et al. (1965) Nonsense mutants and polarity in the lac operon of Escherichia coli. J. Mol. Biol. 14 290-6 PubMed EcoliWiki page
  5. Mandecki, W et al. (1981) Position of the lacZX90 mutation and hybridization between complete and incomplete beta-galactosidase. J. Bacteriol. 147 694-7 PubMed EcoliWiki page
  6. Zabin, I et al. (1978) Position of the mutation in beta-galactosidase ochre mutant U118. J. Bacteriol. 133 437-8 PubMed EcoliWiki page
  7. Epstein, W (1967) Transposition of the lac region of Escherichia coli. IV. Escape from repression in bacteriophage-carried lac genes. J. Mol. Biol. 30 529-43 PubMed EcoliWiki page
  8. 8.0 8.1 8.2 8.3 8.4 Zipser, D et al. (1970) Fine structure of the gradient of polarity in the z gene of the lac operon of Escherichia coli. J. Mol. Biol. 49 251-4 PubMed EcoliWiki page
  9. Hoess, RH & Herman, RK (1975) Isolation and characterization of mutator strains of Escherichia coli K-12. J. Bacteriol. 122 474-84 PubMed EcoliWiki page
  10. Normanly, J et al. (1990) Construction of Escherichia coli amber suppressor tRNA genes. III. Determination of tRNA specificity. J. Mol. Biol. 213 719-26 PubMed EcoliWiki page
  11. Foster, TJ (1977) Insertion of the tetracycline resistance translocation unit Tn10 in the lac operon of Escherichia coli K12. Mol. Gen. Genet. 154 305-9 PubMed EcoliWiki page
  12. Datsenko, KA & Wanner, BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97 6640-5 PubMed EcoliWiki page
  13. 13.0 13.1 13.2 13.3 13.4 13.5 Cupples, CG & Miller, JH (1989) A set of lacZ mutations in Escherichia coli that allow rapid detection of each of the six base substitutions. Proc. Natl. Acad. Sci. U.S.A. 86 5345-9 PubMed EcoliWiki page
  14. Bukhari, AI & Allet, B (1975) Plaque-forming lambda-Mu hybrids. Virology 63 30-9 PubMed EcoliWiki page
  15. Reddy, M & Gowrishankar, J (1997) Identification and characterization of ssb and uup mutants with increased frequency of precise excision of transposon Tn10 derivatives: nucleotide sequence of uup in Escherichia coli. J. Bacteriol. 179 2892-9 PubMed EcoliWiki page
  16. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  17. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  18. 18.0 18.1 CGSC: The Coli Genetics Stock Center
  19. 19.0 19.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories