PortEco logo

lamB:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

lamB

Mnemonic

Lambda

Synonyms

ECK4028, b4036, JW3996, malB, malL[1], malL

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

91.51 minutes 

MG1655: 4245994..4247334


REL606

NC_012967: 4226903..4228243


BW2952

NC_012759: 4184839..4186179


W3110

 

W3110: 4251561..4252901


DH10B

DH10B: 4345690..4347030


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

4246069

Edman degradation

PMID:346375[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔlamB (Keio:JW3996)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC10877[4]

lamBR134D,N

R134D,N

Slight increase in pore size; increase in sucrose transport and slight decrease in maltose transport; when associated with D-143 and F-146

seeded from UniProt:P02943

lamBY143F

Y143F

Increases affinity for starch and maltose, pore size and transport of maltohexaose

seeded from UniProt:P02943

lamBD146G

D146G

Increases affinity for large dextrins

seeded from UniProt:P02943

lamBW99R

W99R

Decreases starch affinity, slightly increases maltose affinity

seeded from UniProt:P02943

lamBR107S

R107S

Decreases maltodextrin affinity, increases sucrose binding and transport

seeded from UniProt:P02943

lamBR134A

R134A

Considerable increase in pore size and sucrose transport, slight decrease in maltose transport; when associated with A-143

seeded from UniProt:P02943

lamBR33H

R33H

Reduces ligand affinity and pore size, no longer selective for maltodextrins

seeded from UniProt:P02943

ΔlamB::kan

deletion

Biolog:respiration

unable to respire Dextrin

PMID:16095938[5]

lamB63

PMID:778586[6] PMID:329879[7]

CGSC:8261

lamB204(Am)

CGSC:9968

amber (UAG) mutation

lamB60::Tn10

CGSC:12195

lamB20::Tn5

CGSC:14652

lamB2000(LamR)

lambda resistant

CGSC:65959

ΔlamB732::kan

PMID:16738554[3]

CGSC:101636


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3996

Plasmid clone

Shigen

PMID:16769691[8]

Status:Clone OK

Primer 1:GCCATGATTACTCTGCGCAAACT

Primer 2:CCCCACCAGATTTCCATCTGGGC

1F8

Kohara Phage

Genobase

PMID:3038334[9]

12B4

Kohara Phage

Genobase

PMID:3038334[9]

malF3089::Tn10

Linked marker

CAG12164 = CGSC7476[4]

est. P1 cotransduction: 84% [10]

zje-2241::Tn10

Linked marker

CAG18427 = CGSC7481[4]

est. P1 cotransduction: 5% [10]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10528

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10528

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000521

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948548

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0523

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0013218

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Edermann, R et al. (1978) Major proteins of the Escherichia coli outer cell envelope membrane. Preliminary characterization of the phage lambda receptor protein. FEBS Lett. 88 71-4 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. Ito, M et al. (2005) Functional analysis of 1440 Escherichia coli genes using the combination of knock-out library and phenotype microarrays. Metab. Eng. 7 318-27 PubMed EcoliWiki page
  6. Hofnung, M et al. (1976) lamB mutations in E. coli K12: growth of lambda host range mutants and effect of nonsense suppressors. Mol. Gen. Genet. 145 207-13 PubMed EcoliWiki page
  7. Braun, V & Krieger-Brauer, HJ (1977) Interrelationship of the phage lambda receptor protein and maltose transport in mutants of Escherichia coli K12. Biochim. Biophys. Acta 469 89-98 PubMed EcoliWiki page
  8. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  9. 9.0 9.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  10. 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories