PortEco logo

mutS:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

mutS

Mnemonic

Mutator

Synonyms

ECK2728, b2733, JW2703, fdv, ant, plm[1], plm

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

61.54 minutes 

MG1655: 2855115..2857676


REL606

NC_012967: 2751953..2754514


BW2952

NC_012759: 2740927..2743488


W3110

 

W3110: 2855749..2858310


DH10B

DH10B: 2947657..2950218


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

mutS(del) (Keio:JW2703)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC10126[3]

mutS::Tn5KAN-I-SceI (FB20917)

Insertion at nt 2340 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20917

contains pKD46

mutS::Tn5KAN-I-SceI (FB20918)

Insertion at nt 2340 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20918

does not contain pKD46

mutS201::Tn5

CGSC:7794

mutS215::Tn10

CGSC:7797

mutS3

CGSC:11134

mutS210

CGSC:85420

mutS104::mini-Tn10

CGSC:85448

mutS738(del)::kan

PMID:16738554[2]

CGSC:101976

MutS F596A

F596A

  • Mildly defective ATPase activity
  • Defective MutH activation in vitro
  • Moderately elevated mutation and DNA recombination rates in vivo

PMID:12606120[5]

MutS H760A

H760A

  • Mildly defective ATPase activity
  • Defective MutH activation in vitro
  • Moderately elevated mutation and DNA recombination rates in vivo


PMID:12606120[5]

MutS H728A

H728A

  • Mildly defective ATPase activity
  • Defective MutH activation in vitro
  • Moderately elevated mutation and DNA recombination rates in vivo

PMID:12606120[5]

MutS S668A/T669A

S668A/T669A

  • Modest reduction of Kcat (~three-fold)
  • Fails to activate MMR

PMID:12606120[5]

MutS D693N

D693N

  • Modest reduction of Kcat (~three-fold)
  • Fails to activate MMR

PMID:12606120[5]

MutS S668A/T669A/E694A

S668A/T669A/E694A

  • Defective in DNA binding
  • Defective in MMR
  • Catalyzes ATP hydrolysis better than single E694A mutant

PMID:12606120[5]

MutS K620M

K620M

  • Severely reduced ATP binding capacity
  • Fails to activate MutH in MMR initiation assays

PMID:12606120[5]

MutS E694Q

E694Q

  • Binds ATP better than the wt MutS,but hydrolyzes ATP poorly
  • Supports low-level MutH activation in a mismatch-independent manner

PMID:12606120[5]

MutS F36A

F36A

  • Fails to recognize a mismatch site hence failing to initiate MMR
  • Loses mismatch binding capacity

PMID:12606120[5]

MutS D693A

D693A

  • Binds ATP better than the wt MutS,but hydrolyzes ATP poorly
  • Supports low-level MutH activation in a mismatch-independent manner

PMID:12606120[5]

MutS E38Q

E38Q

  • Binds DNA better than wt MutS
  • Activates MutH ~50% more than the wt MutS in correlation with increased affinity for heteroduplex DNA
  • Completely inactive in MMR and in preventing homologous recombination in vivo

PMID:12606120[5]

MutS E694A

E694A

  • Binds ATP better than the wt MutS,but hydrolyzes ATP poorly
  • Supports low-level MutH activation in a mismatch-independent manner

PMID:12606120[5]

MutS E38A

E38A

  • Exhibits moderately increased affinity for homoduplex DNA in vitro
  • MMR defective in vivo

PMID:12606120[5]

MutS E177A

E177A

  • Unable to form H bonds that link domains I and II
  • Indistinguishable from ΔmutS in the in vivo MMR and recombination assays
  • Possesses a lower affinity for heteroduplex DNA in vitro in the presence of ATP
  • Possesses a higher affinity for homoduplex DNA in vitro in the presence of ATP
  • Hyperactive in activating MutH with 2-fold and 4-fold increases observed relative to the wt MutS for heteroduplex and homoduplex DNA, respectively
  • Reduced ATP hydrolysis

PMID:12606120[5]

MutS T115A

T115A

  • Unable to form H bonds that link domains I and II
  • Indistinguishable from ΔmutS in the in vivo MMR and recombination assays
  • Possesses a lower affinity for heteroduplex DNA in vitro in the presence of ATP
  • Possesses a higher affinity for homoduplex DNA in vitro in the presence of ATP
  • Hyperactive in activating MutH with 2-fold and 4-fold increases observed relative to the wt MutS for heteroduplex and homoduplex DNA, respectively
  • Reduced ATP hydrolysis

PMID:12606120[5]

MutS R197E/R198E

R197E/R198E

  • Disrupts the domain interface more extensively than the E177A or T115A mutation
  • In vivo defects similar to E177A and T115A mutations
  • Relatively normal DNA binding
  • Slightly elevated affinity for homoduplex DNA in the presence of ATP
  • Completely fails to activate MutH in vitro

PMID:12606120[5]

MutS

Overexpression of MutS

Mutation Frequence

The rate of GC transversion to TA is reduced.

PMID 10940054

See Fig 1

MutS R197E/R198E/R199E

R197E/R198E/R199E

  • Disrupts the domain interface more extensively than the E177A or T115A mutation
  • In vivo defects similar to E177A and T115A mutations
  • Probably results in an unstable protein, which is found in inclusion bodies when over-expressed

PMID:12606120[5]

MutS

Overexpression of MutS

Mutation Frequence

the amount of mutations due to MutY are decreased.

PMID 10940054

See Fig 3

Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2703

Plasmid clone

Shigen

PMID:16769691[6]

Status:Clone OK

Primer 1:GCCAGTGCAATAGAAAATTTCGA

Primer 2:CCaACCAGGCTCTTCAAGCGATA

12F2

Kohara Phage

Genobase

PMID:3038334[7]

25D2

Kohara Phage

Genobase

PMID:3038334[7]

srlD3131::Tn10

Linked marker

CAG18642 = CGSC7423[3]

est. P1 cotransduction: 32% [8]
Synonyms:zfh-3131::Tn10, zfi-3131::Tn10

cysI95::Tn10

Linked marker

CAG12173 = CGSC7425[3]

est. P1 cotransduction: 30% [8]
Synonyms:cysC95::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10625

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10625

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000618

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947206

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0620

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0008977

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
  4. 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 Junop, MS et al. (2003) In vitro and in vivo studies of MutS, MutL and MutH mutants: correlation of mismatch repair and DNA recombination. DNA Repair (Amst.) 2 387-405 PubMed EcoliWiki page
  6. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  7. 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  8. 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories