Try the new EcoliHub and let us know what you'd like to see.
nlpA:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nlpA |
|---|---|
| Mnemonic |
New lipoprotein |
| Synonyms |
ECK3651, b3661, JW3635[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
82.7 minutes |
MG1655: 3838016..3837198 | ||
|
NC_012967: 3799925..3799107 | ||||
|
W3110 |
|
W3110: 3800422..3801240 | ||
|
DH10B: 3935600..3934782 | ||||
|
NC_012759: 3725531..3726349 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔnlpA (Keio:JW3635) |
deletion |
deletion | |||||
|
nlpA::kan |
Other |
nonessential | |||||
|
nlpA3085::Tn10 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3635 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACTGACAACACATCATCT Primer 2:CCCCAGCCAGGCACCGCGCCACC | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: 72% [8] | |
|
zid-501::Tn10 |
Linked marker |
est. P1 cotransduction: 22% [8] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ Yamaguchi K & Inouye M (1988) Lipoprotein 28, an inner membrane protein of Escherichia coli encoded by nlpA, is not essential for growth. J Bacteriol 170: 3747-9 PubMed EcoliWiki page
- ↑ Nichols BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J Bacteriol 180: 6408-11 PubMed EcoliWiki page
- ↑ Singer M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol Rev 53: 1-24 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 7.0 7.1 CGSC: The Coli Genetics Stock Center
- ↑ 8.0 8.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
