Try the new EcoliHub and let us know what you'd like to see.
nuoB:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
nuoB |
|---|---|
| Gene Synonym(s) |
ECK2281, b2287, JW5875[1] |
| Product Desc. |
Component of connecting fragment of NADH dehydrogenase I[3]; NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit B, complex I; NADH dehydrogenase I[4] |
| Product Synonyms(s) |
NADH:ubiquinone oxidoreductase, chain B[1], B2287[2][1], NuoB[2][1] |
| Function from GO |
Cellular Component
Molecular Function
Biological Process |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): nuoABCEFGHIJKLMN[2], nuo1-14 |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
NuoB has iron-sulfur cluster N2. HT_Cmplx18_Mem: NuoB+NuoC.[4]
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
nuoB |
|---|---|
| Mnemonic |
NADH:ubiquinone oxidoreductase |
| Synonyms |
ECK2281, b2287, JW5875[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
51.77 minutes |
MG1655: 2402635..2401973 | ||
|
NC_012967: 2348204..2347542 | ||||
|
W3110 |
|
W3110: 2409283..2408621 | ||
|
DH10B: 2494400..2493738 | ||||
|
NC_012759: 2287778..2288440 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔnuoB (Keio:JW5875) |
deletion |
deletion |
PMID:16738554 | ||||
|
PMID:12519969 |
At position 608 in Plus orientation, contains plasmid pKD46. | ||||||
|
PMID:12519969 |
At position 608 in Plus orientation, does not contain plasmid pKD46. | ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5875 |
Plasmid clone |
PMID:16769691 Status:cloned as old JW Primer 1:GCCGATTATACGCTCACCCGCAT Primer 2:CCAATCTCGTCAGGTGTACGCAG | |
|
Linked marker |
est. P1 cotransduction: 65% [6] | ||
|
zfd-1::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
NuoB |
|---|---|
| Synonyms |
NADH:ubiquinone oxidoreductase, chain B[1], B2287[2][1], NuoB[2][1] |
| Product description |
Component of connecting fragment of NADH dehydrogenase I[3]; NADH dehydrogenase I[2][3] NADH:ubiquinone oxidoreductase subunit B, complex I; NADH dehydrogenase I[4] |
| EC number (for enzymes) | |
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0005886 |
plasma membrane |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0008137 |
NADH dehydrogenase (ubiquinone) activity |
PMID:9495756 |
IMP: Inferred from Mutant Phenotype |
F |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0009060 |
aerobic respiration |
PMID:9495756 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0009061 |
anaerobic respiration |
PMID:9063459 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0015453 |
oxidoreduction-driven active transmembrane transporter activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0015990 |
electron transport coupled proton transport |
PMID:16807239 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0030964 |
NADH dehydrogenase complex |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0045272 |
plasma membrane respiratory chain complex I |
PMID:11997136 |
IDA: Inferred from Direct Assay |
C |
Seeded from EcoCyc [8] |
complete | ||
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
PMID:12975362 |
IMP: Inferred from Mutant Phenotype |
F |
Seeded from EcoCyc 12.5 [7] |
complete | ||
|
GO:0005506 |
iron ion binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0408 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0006120 |
mitochondrial electron transport, NADH to ubiquinone |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006137 |
P |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0008137 |
NADH dehydrogenase (ubiquinone) activity |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006137 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
GO:0046872 |
metal ion binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0479 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0048038 |
quinone binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0874 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014406 |
F |
Seeded from EcoCyc 12.5 [7] |
complete | |
|
NOT |
GO:0005737 |
cytoplasm |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
Seeded from Riley et al 2006 [1]. See discussion page for explanation of the 'NOT' qualifier. |
complete | |
|
GO:0006810 |
transport |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0813 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0016020 |
membrane |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0472 |
C |
Seeded from EcoCyc [8] |
complete | |
|
GO:0016491 |
oxidoreductase activity |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0560 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0016651 |
oxidoreductase activity, acting on NADH or NADPH |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR014406 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0019684 |
photosynthesis, light reaction |
GO_REF:0000020 |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01356 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0050136 |
NADH dehydrogenase (quinone) activity |
GO_REF:0000003 |
IEA: Inferred from Electronic Annotation |
EC:1.6.99.5 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0051536 |
iron-sulfur cluster binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0411 |
F |
Seeded from EcoCyc [8] |
complete | |
|
GO:0055114 |
oxidation reduction |
GO_REF:0000020 |
IEA: Inferred from Electronic Annotation |
HAMAP:MF_01356 |
P |
Seeded from EcoCyc [8] |
complete | |
|
GO:0009061 |
anaerobic respiration |
PMID:9063459 |
IMP: Inferred from Mutant Phenotype |
P |
Seeded from EcoCyc 11.1[3]. Growth with fumarate as the terminal electron acceptor requires NADH dehydrogenase I. |
complete | ||
|
GO:0009053 |
electron donor activity |
F |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
|
GO:0015453 |
oxidoreduction-driven active transmembrane transporter activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc 11.1[3]. NADH dehydrogenase I in membrane vesicles can generate a H+ electrochemical gradient in the presence of deamino-NADH and ubiquinone-1. |
complete | ||
|
GO:0030964 |
NADH dehydrogenase complex |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The E. coli NADH dehydrogenase complex was purified and the subunits separated by SDS-PAGE. The N-termini of these 6 polypeptides were sequenced after deblocking with methanolic HCl. |
complete | ||
|
GO:0005886 |
plasma membrane |
PMID:7607227 |
IDA: Inferred from Direct Assay |
C |
The NADH dehydrogenase I complex fractionates with cytoplasmic membranes. |
complete | ||
|
Contributes to |
GO:0003954 |
NADH dehydrogenase activity |
PMID:3122832 |
IDA: Inferred from Direct Assay |
F |
Purified NADH dehydrogenase I in membrane vesicles can oxidize NADH. |
complete | |
|
GO:0051539 |
4 iron, 4 sulfur cluster binding |
PMID:12975362 |
IMP: Inferred from Mutant Phenotype |
F |
Mutation of cysteine residues in nuoB results in loss of the EPR spectral signal characteristic of the N2 [4Fe-4S] cluster in NADH dehydrogenase I. |
complete | ||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of connecting fragment of NADH dehydrogenase I |
could be indirect | ||
|
Protein |
Subunits of NADH dehydrogenase I |
could be indirect |
| |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
|
Cytoplasm |
PMID:7607227 |
| ||
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MDYTLTRIDP NGENDRYPLQ KQEIVTDPLE QEVNKNVFMG KLNDMVNWGR KNSIWPYNFG LSCCYVEMVT SFTAVHDVAR FGAEVLRASP RQADLMVVAG TCFTKMAPVI QRLYDQMLEP KWVISMGACA NSGGMYDIYS VVQGVDKFIP VDVYIPGCPP RPEAYMQALM LLQESIGKER RPLSWVVGDQ GVYRANMQSE RERKRGERIA VTNLRTPDEI |
|---|---|
| Length |
220 |
| Mol. Wt |
25.055 kDa |
| pI |
5.6 (calculated) |
| Extinction coefficient |
36,900 - 37,525 (calc based on 10 Y, 4 W, and 5 C residues) |
| edit table |
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for nuoB | |
|
microarray |
Summary of data for nuoB from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Accessions Related to nuoB Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Ciona intestinalis |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Gallus gallus |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
NUOB |
From SHIGELLACYC |
|
E. coli O157 |
NUOB |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 3.5 3.6 3.7 3.8 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 8.00 8.01 8.02 8.03 8.04 8.05 8.06 8.07 8.08 8.09 8.10 8.11 8.12 8.13 8.14 8.15 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
Categories
