PortEco logo

pBR322

From EcoliWiki
Jump to: navigation, search

At a Glance

Image of pBR322. In red is the bla, while blue encodes for tetracycline resistance. Green shows the origin of replication.

Type

Cloning

Origin of Replication

ColE1

Copy #

20 per cell

Markers

Tetracycline Ampicillin

Link to Sequence

GenBank

Features

Can be amplified with chloramphenicol or spectinomycin

Accession Number

J01749



History

You can help EcoliWiki by writing about the history of this plasmid.

Sources

Invitrogen

Promega

Roche Applied Science

Sequence

TTCTCATGTTTGACAGCTTATCATCGATAAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAA
TCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGC
GGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCT
CGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACA
CCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCA
CCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTT
GGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCG
CATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACTATCGTCGCCGCAC
TTATGACTGTCTTCTTTATCATGCAACTCGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAGCGC
GACGATGATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACTGGTCCCGCCACCAAACGTTTCGGC
GAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCTACGTCTTGCTGGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCA
TTATGATTCTTCTCGCTTCCGGCGGCATCGGGATGCCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCT
TCAAGGATCGCTCGCGGCTCTTACCAGCCTAACTTCGATCATTGGACCGCTGATCGTCACGGCGATTTATGCCGCCTCGGCGAGCACATGG
AACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCCGCGTTGCGTCGCGGTGCATGGAGCCGGGCCACCTCGACCT
GAATGGAAGCCGGCGGCACCTCGCTAACGGATTCACCACTCCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACC
AACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCTGGCCACGGGTGC
GCATGATCGTGCTCCTGTCGTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTACTGGTTAGCAGAATGAATCACCGATACGCGAGCGAAC
GTGAAGCGACTGCTGCTGCAAAACGTCTGCGACCTGAGCAACAACATGAATGGTCTTCGGTTTCCGTGTTTCGTAAAGTCTGGAAACGCGG
AAGTCAGCGCCCTGCACCATTATGTTCCGGATCTGCATCGCAGGATGCTGCTGGCTACCCTGTGGAACACCTACATCTGTATTAACGAAGC
GCTGGCATTGACCCTGAGTGATTTTTCTCTGGTCCCGCCGCATCCATACCGCCAGTTGTTTACCCTCACAACGTTCCAGTAACCGGGCATG
TTCATCATCAGTAACCCGTATCGTGAGCATCCTCTCTCGTTTCATCGGTATCATTACCCCCATGAACAGAAATCCCCCTTACACGGAGGCA
TCAGTGACCAAACAGGAAAAAACCGCCCTTAACATGGCCCGCTTTATCAGAAGCCAGACATTAACGCTTCTGGAGAAACTCAACGAGCTGG
ACGCGGATGAACAGGCAGACATCTGTGAATCGCTTCACGACCACGCTGATGAGCTTTACCGCAGCTGCCTCGCGCGTTTCGGTGATGACGG
TGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCA
GCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCA
GATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCG
CTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGG
ATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCG
CCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGA
AGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATA
GCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGC
CTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCG
AGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGA
AGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCA
GATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGG
ATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGT
AAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCC
CGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGAT
TTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCC
GGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGG
TATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCT
CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAA
GATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACG
GGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTG
TTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAG
GAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTA
TCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG
CCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAA

References

[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [2]

  1. Bolivar, F et al. (1977) Construction and characterization of new cloning vehicles. II. A multipurpose cloning system. Gene 2 95-113 PubMed EcoliWiki page
  2. 2.0 2.1 Watson, N (1988) A new revision of the sequence of plasmid pBR322. Gene 70 399-403 PubMed EcoliWiki page
  3. Sutcliffe, JG (1978) Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proc. Natl. Acad. Sci. U.S.A. 75 3737-41 PubMed EcoliWiki page
  4. Sutcliffe, JG (1979) Complete nucleotide sequence of the Escherichia coli plasmid pBR322. Cold Spring Harb. Symp. Quant. Biol. 43 Pt 1 77-90 PubMed EcoliWiki page
  5. Reed, RR et al. (1979) Transposition of the Escherichia coli insertion element gamma generates a five-base-pair repeat. Proc. Natl. Acad. Sci. U.S.A. 76 4882-6 PubMed EcoliWiki page
  6. Covarrubias, L et al. () Construction and characterization of new cloning vehicles. V. Mobilization and coding properties of pBR322 and several deletion derivatives including pBR327 and pBR328. Gene 13 25-35 PubMed EcoliWiki page
  7. Marians, KJ et al. (1982) Maximal limits of the Escherichia coli replication factor Y effector site sequences in pBR322 DNA. J. Biol. Chem. 257 5656-62 PubMed EcoliWiki page
  8. Brosius, J et al. (1982) Precise location of two promoters for the beta-lactamase gene of pBR322. S1 mapping of ribonucleic acid isolated from Escherichia coli or synthesized in vitro. J. Biol. Chem. 257 9205-10 PubMed EcoliWiki page
  9. Van Dyke, MW et al. (1982) Map of distamycin, netropsin, and actinomycin binding sites on heterogeneous DNA: DNA cleavage-inhibition patterns with methidiumpropyl-EDTA.Fe(II). Proc. Natl. Acad. Sci. U.S.A. 79 5470-4 PubMed EcoliWiki page
  10. Larrouy, G et al. (1981) [Obtaining intraerythrocytic forms of Plasmodium vivax by in vitro culture]. C R Seances Acad Sci III 292 929-30 PubMed EcoliWiki page
  11. Peden, KW () Revised sequence of the tetracycline-resistance gene of pBR322. Gene 22 277-80 PubMed EcoliWiki page
  12. Watabe, H et al. (1983) A new class of site-specific endodeoxyribonucleases. Endo.Sce I isolated from a eukaryote, Saccharomyces cerevisiae. J. Biol. Chem. 258 4663-5 PubMed EcoliWiki page
  13. Livneh, Z (1983) Directed mutagenesis method for analysis of mutagen specificity: application to ultraviolet-induced mutagenesis. Proc. Natl. Acad. Sci. U.S.A. 80 237-41 PubMed EcoliWiki page
  14. Mascharak, PK et al. (1983) Alteration and activation of sequence-specific cleavage of DNA by bleomycin in the presence of the antitumor drug cis-diamminedichloroplatinum(II). Proc. Natl. Acad. Sci. U.S.A. 80 6795-8 PubMed EcoliWiki page
  15. Schultz, PG & Dervan, PB (1983) Sequence-specific double-strand cleavage of DNA by penta-N-methylpyrrolecarboxamide-EDTA X Fe(II). Proc. Natl. Acad. Sci. U.S.A. 80 6834-7 PubMed EcoliWiki page
  16. Fuller, RS et al. (1984) The dnaA protein complex with the E. coli chromosomal replication origin (oriC) and other DNA sites. Cell 38 889-900 PubMed EcoliWiki page
  17. Lathe, R et al. (1984) Linker tailing: unphosphorylated linker oligonucleotides for joining DNA termini. DNA 3 173-82 PubMed EcoliWiki page
  18. Gonzalez, B et al. (1984) Electron microscopy mapping of Escherichia coli RNA polymerase-binding sites on plasmids from thermophilic bacteria. DNA 3 251-7 PubMed EcoliWiki page
  19. Abarzúa, P et al. (1984) Mutational analysis of primosome assembly sites. I. Distinct classes of mutants in the pBR322 Escherichia coli factor Y DNA effector sequences. J. Biol. Chem. 259 14286-92 PubMed EcoliWiki page
  20. Soeller, W et al. (1984) Mutational analysis of primosome assembly sites. II. Role of secondary structure in the formation of active sites. J. Biol. Chem. 259 14293-300 PubMed EcoliWiki page
  21. Van Dyke, MM & Dervan, PB (1984) Echinomycin binding sites on DNA. Science 225 1122-7 PubMed EcoliWiki page