PortEco logo

pCOIN DV

From EcoliWiki
Jump to: navigation, search

See Help:Plasmid for more information about plasmids in EcoliWiki.


At a Glance

pCOIN DV, image BCCM/LMBP

Type

Multisite GatewayTM Destination vector

Origin of Replication

pMB1

Copy #
Markers

Ampicillin Chloramphenicol

Link to Sequence

LMBP 8192

Features
Accession Number



Notes

pCOIN DV is a highly efficient Recombinase-Mediated Cassette Exchange (RMCE)-compatible, conditonal and inducible Gateway destination vector.
This multisite Gateway destination vector contains the ccdB gene inserted between the attenuator sites attR3 and attR4. Next to this plasmid, three entry clones are needed in the multisite approach to target the gene of interest to the endogeneous ROSA26 locus in mouse G4 ROSALUC ES cells: 1) a 5' entry clone with attL4-attR1 sites and containing the reverse tetracycline transactivator (rtTA), followed by an IRES-puromycin-polyA cassette (e.g. pEntry L4 rtTA-IRES-Puro-pA-Ins/Ins-TRE R1); 2) a middle entry clone with attL1-attL2 sites and containing the gene of interest and 3) a 3' entry clone with attR2-attL3 sites and containing the IRES-EGFP-Luciferase-polyA cassette (e.g. pEntry attR2-IRES-eGFP-luc+-pA-attL3).

The plasmid contains:
- two heterospecific Saccharomyces cerevisiae 2μ FLP Recombinase Target sites (one wt and one mutant FRT site)
- two bacteriophage P1 Cre recombinase target sites (loxP sites)
- two adjacent copies of the chicken β-globin 5' DNase I hypersensitive site 4 (5'HS4) insulator core sequence. Insulators are DNA sequences which possess the ability to protect expressing genes from inappropriate signals emanating from their surrounding environment by acting as barriers that prevent the advance of nearby condensed chromatin that may otherwise silence expression.
- a splice acceptor (SA) for linking the rtTA-IRES-puromycin to the endogenous ROSA26 promoter.

The resulting multisite Gateway expression vector, by co-transfection of a FlpE plasmid, can subsequently be targeted to the ROSA26 locus of G4 ROSALUC ES cells using a trap-coupled RMCE approach, hereby restoring neomycin resistance. Cre-mediated removal of the loxP-flanked conditional stop cassette leads to ROSA26-based rtTA expression and puromycin resistance. Inducible expression of the inserted cDNA will only be achieved upon doxycycline administration and can be monitored by the induced reporter expression (EGFP-LUC).


History

You can help EcoliWiki by writing about the history of this plasmid.

Sources

BCCM/LMBP Plasmid Collection

References

Haenebalcke et al., Stem Cell Rev. 6 (2013), 774-785

Sequence

CGCGCCGGGCCCTCGCGACTCGAGGAATAAATTCGAGCTCACGGGGACAGCCCCCCCCCA
AAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAGCGAGCCGCCCGG
GGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCGAGCCGGCAGCGTGCGGGGACAGC
CCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCCTCTGAACGCTTCTCGCTGCTCTTTG
AGCCTGCAGACACCTGGGGGATACGGGGAAAAAGCTTGAGCTCACGGGGACAGCCCCCCC
CCAAAGCCCCCAGGGATGTAATTACGTCCCTCCCCCGCTAGGGGGCAGCAGCGAGCCGCC
CGGGGCTCCGCTCCGGTCCGGCGCTCCCCCCGCATCCCCGAGCCGGCAGCGTGCGGGGAC
AGCCCGGGCACGGGGAAGGTGGCACGGGATCGCTTTCCTCTGAACGCTTCTCGCTGCTCT
TTGAGCCTGCAGACACCTGGGGGATACGGGGAAAAAGCTTGTCGACGAATAAATTCAATT
CTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTAGCAGCCCC
GCTGGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACATCCACCGG
TAGGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCCTCCCCT
AGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAATGGAAGT
AGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCGGGTAGG
CCTTTGGGGCAGCGGCCAATAGCAGCTTTGCTCCTTCGCTTTCTGGGCTCAGAGGCTGGG
AAGGGGTGGGTCCGGGGGCGGGCTCAGGGGCGGGCTCAGGGGCGGGGCGGGCGCCCGAAG
GTCCTCCGGAGGCCCGGCATTCTGCACGCTTCAAAAGCGCACGTCTGCCGCGCTGTTCTC
CTCTTCCTCATCTCCGGGCCTTTCGACCTGCAATCGCCGCCACCATGGAGAAGTTCCTAT
TCCGAAGTTCCTATTCTTCAAAAGGTATAGGAACTTCCGATCGGGATCCCCAATCCTGCA
TGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCAC
AATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGT
GAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTC
GTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCG
CTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGT
ATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAA
GAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGC
GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAG
GTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGT
GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG
AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCG
CTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGG
TAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCAC
TGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTG
GCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGT
TACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGG
TGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCC
TTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTT
GGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTT
TAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAG
TGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGT
CGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACC
GCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGC
CGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCG
GGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTAC
AGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACG
ATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCC
TCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACT
GCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTC
AACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAAT
ACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTC
TTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCAC
TCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAA
AACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACT
CATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGG
ATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCG
AAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAG
GCGTATCACGAGGCCCTTTCGTCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACA
CATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGC
CCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATC
AGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAG
GAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCG
ATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCG
ATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGA
ATTCCACAAAAGTGCGATCGGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATA
GGAACTTCTTAATTAAGGGATCTGTAGGGCGCAGTAGTCCAGGGTTTCCTTGATGATGTC
ATACTTATCCTGTCCCTTTTTTTTCCACAGCTCGCGGTTGAGGACAAACTCTTCGCGGTC
TTTCCAGTGGGGATCGACGGTATCGTAGAGTCGAGGCCGCTCTAGAACTAGTGGATCCGG
AACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCCCTCGACCTG
CAGGAATTCTACCGGGTAGGGGAGGCGCTTTTCCCAAGGCAGTCTGGAGCATGCGCTTTA
GCAGCCCCGCTGGCACTTGGCGCTACACAAGTGGCCTCTGGCCTCGCACACATTCCACAT
CCACCGGTAGCGCCAACCGGCTCCGTTCTTTGGTGGCCCCTTCGCGCCACCTTCTACTCC
TCCCCTAGTCAGGAAGTTCCCCCCCGCCCCGCAGCTCGCGTCGTGCAGGACGTGACAAAT
GGAAGTAGCACGTCTCACTAGTCTCGTGCAGATGGACAGCACCGCTGAGCAATGGAAGCG
GGTAGGATCATAATTTAAACAAGCAAAACCAAATTAAGGGCCAGCTCATTCCTCCCACTC
ATGATCTATAGATCTATAGATCTCTCGTGGGATCATTGTTTTTCTCTTGATTCCCACTTT
GTGGTTCTAAGTACTGTGGTTTCCAAATGTGTCAGTTTCATAGCCTGAAGAACGAGATCA
GCAGCCTCTGTTCCACATACACTTCATTCTCAGTATTGTTTTGCCAAGTTCTAATTCCAT
CAGAAGCTTGCAGATCTGCGACTCTAGAGGATCTGCGACTCTAGAGGATCATAATCAGCC
ATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACC
TGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTT
ACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTA
GTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTGCGACTCTAGAG
GATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACA
CCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGC
AGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTT
TTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGAT
CTGCGACTCTAGAGGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTA
AAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTT
AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACA
AATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCT
TATCATGTCTGGATCCCCATCAAGCTGATCCGGAACCCTTAATATAACTTCGTATAATGT
ATGCTATACGAAGTTATTAGGTCCCTCGACCTGCAGCCCAAGCTAGCTTATCGATACCGT
CGACNCTCGAGNTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTATCAACT
TTGTATAGAAAAGTTGAACGAGAAACGTAAAATGATATAAATATCAATATATTAAATTAG
ATTTTGCATAAAAAACAGACTACATAATACTGTAAAACACAACATATCCAGTCACTATGG
TCGACCTGCAGACTGGCTGTGTATAAGGGAGCCTGACATTTATATTCCCCAGAACATCAG
GTTAATGGCGTTTTTGATGTCATTTTCGCGGTGGCTGAGATCAGCCACTTCTTCCCCGAT
AACGGAGACCGGCACACTGGCCATATCGGTGGTCATCATGCGCCAGCTTTCATCCCCGAT
ATGCACCACCGGGTAAAGTTCACGGGGGACTTTATCTGACAGCAGACGTGCACTGGCCAG
GGGGATCACCATCCGTCGCCCGGGCGTGTCAATAATATCACTCTGTACATCCACAAACAG
ACGATAACGGCTCTCTCTTTTATAGGTGTAAACCTTAAACTGCATTTCACCAGCCCCTGT
TCTCGTCGGCAAAAGAGCCGTTCATTTCAATAAACCGGGCGACCTCAGCCATCCCTTCCT
GATTTTCCGCTTTCCAGCGTTCGGCACGCAGACGACGGGCTTCATTCTGCATGGTTGTGC
TTACCGAACCGGAGATATTGACATCATATATGCCTTGAGCAACTGATAGCTGTCGCTGTC
AACTGTCACTGTAATACGCTGCTTCATAGCATACCTCTTTTTGACATACTTCGGGTATAC
ATATCAGTATATATTCTTATACCGCAAAAATCAGCGCGCAAATACGCATACTGTTATCTG
GCTTTTAGTAAGCCGGATCCTCTAGATTACGCCCCGCCCTGCCACTCATCGCAGTACTGT
TGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCACAAACGGCATGATGAACCTGA
ATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATAATATTTGCCCATGGTGAAAACG
GGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAG
GGATTGGCTGAGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT
TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAAATCGTCGTGG
TATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCATGGAAAACGGTGTAACAAGGG
TGAACACTATCCCATATCACCAGCTCACCGTCTTTCATTGCCATACGGAATTCCGGATGA
GCATTCATCAGGCGGGCAAGAATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTC
TTTACGGTCTTTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA
GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATATATCAACGGTG
GTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACGGA
TCCTAACTCAAAATCCACACATTATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTG
CCTAATGCGGCCGCCATAGTGACTGGATATGTTGTGTTTTACAGTATTATGTAGTCTGTT
TTTTATGCAAAATCTAATTTAATATATTGATATTTATATCATTTTACGTTTCTCGTTCAA
CTTTATTATACATAGTTGATAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAA
ACGAGCTCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCC
CTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAA
TGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGG
GCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGG
CTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCGATCCTCTAGTTGG