PortEco logo

pCX

From EcoliWiki
Jump to: navigation, search

At a Glance

pCX Image made with PlasMapper

Type

Control

Origin of Replication

pUC

Copy #
Markers

Chloramphenicol acetyltransferase

Link to Sequence

Invitrogen

Features

lac promoter
lacoperator
Ribosome binding site
M13 reverse priming site
CX leader
Truncated RsaA ORF
RsaA reverse priming site
oriV
Kanamycin promoter
Chloramphenicol acetyltransferase ORF

Accession Number




Notes

pCX is a 5343 bp control vector which expresses a truncated RsaA protein (amino acids 690-1026). pCX is the parent vector of pCX-TOPO and may be used as a positive expression control. The recombinant RsaA protein produced from pCX is 33 kDa in size.

History

You can help EcoliWiki by writing about the history of this plasmid.

Sources

Invitrogen

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

[1] [2] [3]

Sequence

GCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCT
CGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAAT
TCCCGGGGATCCGTCGCTGACCCGGCCTTCGGCGGCTTCGAAACCCTCCGCGTCGCTGGCGCGGCGGCTC
AAGGCTCGCACAACGCCAACGGCTTCACGGCTCTGCAACTGGGCGCGACGGCGGGTGCGACGACCTTCAC
CAACGTTGCGGTGAATGTCGGCCTGACCGTTCTGGCGGCTCCGACCGGTACGACGACCGTGACCCTGGCC
AACGCCACGGGCACCTCGGACGTGTTCAACCTGACCCTGTCGTCCTCGGCCGCTCTGGCCGCTGGTACGG
TTGCGCTGGCTGGCGTCGAGACGGTGAACATCGCCGCCACCGACACCAACACGACCGCTCACGTCGACAC
GCTGACGCTGCAAGCCACCTCGGCCAAGTCGATCGTGGTGACGGGCAACGCCGGTCTGAACCTGACCAAC
ACCGGCAACACGGCTGTCACCAGCTTCGACGCCAGCGCCGTCACCGGCACGGGCTCGGCTGTGACCTTCG
TGTCGGCCAACACCACGGTGGGTGAAGTCGTCACGATCCGCGGCGGCGCTGGCGCCGACTCGCTGACCGG
TTCGGCCACCGCCAATGACACCATCATCGGTGGCGCTGGCGCTGACACCCTGGTCTACACCGGCGGTACG
GACACCTTCACGGGTGGCACGGGCGCGGATATCTTCGATATCAACGCTATCGGCACCTCGACCGCTTTCG
TGACGATCACCGACGCCGCTGTCGGCGACAAGCTCGACCTCGTCGGCATCTCGACGAACGGCGCTATCGC
TGACGGCGCCTTCGGCGCTGCGGTCACCCTGGGCGCTGCTGCGACCCTGGCTCAGTACCTGGACGCTGCT
GCTGCCGGCGACGGCAGCGGCACCTCGGTTGCCAAGTGGTTCCAGTTCGGCGGCGACACCTATGTCGTCG
TTGACAGCTCGGCTGGCGCGACCTTCGTCAGCGGCGCTGACGCGGTGATCAAGCTGACCGGTCTGGTCAC
GCTGACCACCTCGGCCTTCGCCACCGAAGTCCTGACGCTCGCCTAAGCGAACGTCTGATCCTCGCCTAGG
CGAGGATCGCTAGACTAAGAGACCCCGTCTTCCGAAAGGGAGGCGGGGTCTTTCTTATGGGCGCTACGCG
CTGGCCGGCCTTGCCTAGTTCCGGTGGCTATGATTTAGCGGGACTGGGGGGCTTGCTCACTTTCCGCCAC
AATTTCGTGGTCGAGACGGCGCCTTAGTTGTTACTGTACATGGCCGCGTCGGTTCGCGCGGCGTCCTGAA
GGCTCACAATGTTCAAGCGCAGCGGCGCGAAGCCGACGATCCTCGACCAGGCCGTGCTGGTCGCCCGCCC
GGCGGTGATCACCGCCATGGTCTTCAGCTTCTTCATCAACATTCTGGCCCTGGTCAGCCCGCTGTACATG
CTGCAGGCATGCAAGCTTGGTACCCTCAGCCGAAATGCCTGCCGTTGCTAGACATTGCCAGCCAGTGCCC
GTCACTCCCGTACTAACTGTCACGAACCCCTGCAATAACTGTCACGCCCCCCTGCAATAACTGTCACGAA
CCCCTGCAATAACTGTCACGCCCCCAAACCTGCAAACCCAGCAGGGGCGGGGGCTGGCGGGGTGTTGGAA
AAATCCATCCATGATTATCTAAGAATAATCCACTAGGCGCGGTTATCAGCGCCCTTGTGGGGCGCTGCTG
CCCTTGCCCAATATGCCCGGCCAGAGGCCGGATAGCTGGTCTATTCGCTGCGCTAGGCTACACACCGCCC
CACCGCTGCGCGGCAGGGGGAAAGGCGGGCAAAGCCCGCTAAACCCCACACCAAACCCCGCAGAAATACG
CTGGAGCGCTTTTAGCCGCTTTAGCGGCCTTTCCCCCTACCCGAAGGGTGGGGGCGCGTGTGCAGCCCCG
CAGGGCCTGTCTCGGTCGATCATTCAGCCCGGCTCATAAGCCGAATTAATTCTGCATCTAGAGGGCCCAA
TTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCT
GGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCC
GCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTA
AGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTT
TCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCC
TTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGT
AGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGAC
TCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCC
GATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATTCAG
GGCGCAAGGGCTGCTAAAGGAAGCGGAACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGAT
GAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGCAGGTAGCTTGCAGT
GGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGG
CGCCCTCTGGTAAGGTTGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATG
GCGCAGGGGATCAAGATCGATCTGTTAACTTTTCAGGAGCTAAGGAAGCTAAAATGGAGAAAAAAATCAC
TGGATATACCACCGTTGATATATCCCAATGGCATCGTAAAGAACATTTTGAGGCATTTCAGTCAGTTGCT
CAATGTACCTATAACCAGACCGTTCAGCTGGATATTACGGCCTTTTTAAAGACCGTAAAGAAAAATAAGC
ACAAGTTTTATCCGGCCTTTATTCACATTCTTGCCCGCCTGATGAATGCTCATCCGGAATTACGTATGGC
AATGAAAGACGGTGAGCTGGTGATATGGGATAGTGTTCACCCTTGTTACACCGTTTTCCATGAGCAAACT
GAAACGTTTTCATCGCTCTGGAGTGAATACCACGACGATTTCCGGCAGTTTCTACACATATATTCGCAAG
ATGTGGCGTGTTACGGTGAAAACCTGGCCTATTTCCCTAAAGGGTTTATTGAGAATATGTTTTTCGTCTC
AGCCAATCCCTGGGTGAGTTTCACCAGTTTTGATTTAAACGTGGCCAATATGGACAACTTCTTCGCCCCC
GTTTTCACCATGGGCAAATATTATACGCAAGGCGACAAGGTGCTGATGCCGCTGGCGATTCAGGTTCATC
ATGCCGTTTGTGATGGCTTCCATGTCGGCAGAATGCTTAATGAATTACAACAGTACTGCGATGAGTGGCA
GGGCGGGGCGTAATTTTTTTAAGGCAGTTATTGTGTTAACAGATCACTCACCAGTCACAGAAAAGCATCT
TACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAAC
TTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAA
CTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCC
TGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAA
TTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGT
TTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGG
TAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAG
ATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTT
AGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGAC
CAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCT
TGAGATCCTTTTTTTCCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTT
TGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAA
ATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCT
CGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCA
AGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGG
AGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGG
GAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGAGAGCGCACGAGGGAGCTTCCAGGGG
GAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATG
CTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGC
TGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTG
AGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGA
GCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTT
CCCGACTGGAAAGCGGGCAGTGA


Cite error: <ref> tags exist, but no <references/> tag was found