PortEco logo

pDG1i-eGFP-V5 blast

From EcoliWiki
Jump to: navigation, search

See Help:Plasmid for more information about plasmids in EcoliWiki.


At a Glance

Type
Origin of Replication
Copy #
Markers
Link to Sequence
Features
Accession Number


Notes

This is a lentiviral Gateway destination vector, with the tet-inducible minimal human CMV-IE promotor.
The plasmid is suitable for microRNA expression.
This vector can not be used to express short hairpin RNA (shRNA), which requires an RNA-polymerase III promotor. However, this vector can be used for knock-down experiments if the hairpin is expressed in a micro-RNA context (eg. Block-iT PolII miR RNAi kit).
The U3 region of the HIV-1 3' LTR is deleted (ΔU3 or dU3) and facilitates self-inactivation of the HIV-1 5' LTR after transduction to enhance the biosafety of the vector. The element also contains a polyadenylation signal for transcription termination and polyadenylation of mRNA in transduced cells.
The vector contains the psi packaging signal, allowing viral packaging, and the rev response element (RRE) from HIV-1, permitting Rev-dependent nuclear export of unspliced viral mRNA.

History

You can help EcoliWiki by writing about the history of this plasmid.

Sources

You can help EcoliWiki by writing about the available sources of this plasmid. BCCM/LMBP Plasmid Collection

References

See Help:References for how to manage references in EcoliWiki. De Groote et al., BioTechniques 60 (2016), 252-259

Sequence

You can help EcoliWiki by providing database accessions or, if none are available, the sequence of this plasmid.

actagtccagtgtggtggaattctgcagatatcaacaagtttgtacaaaaaagctgaacg
agaaacgtaaaatgatataaatatcaatatattaaattagattttgcataaaaaacagac
tacataatactgtaaaacacaacatatccagtcactatggcggccgcattaggcacccca
ggctttacactttatgcttccggctcgtataatgtgtggattttgagttaggatccggcg
agattttcaggagctaaggaagctaaaatggagaaaaaaatcactggatataccaccgtt
gatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgt
acctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaat
aagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccg
gaattccgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgt
tacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgac
gatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctg
gcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtg
agtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttc
accatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggtt
catcatgccgtctgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtac
tgcgatgagtggcagggcggggcgtaaagatctggatccggcttactaaaagccagataa
cagtatgcgtatttgcgcgctgatttttgcggtataagaatatatactgatatgtatacc
cgaagtatgtcaaaaagaggtgtgctatgaagcagcgtattacagtgacagttgacagcg
acagctatcagttgctcaaggcatatatgatgtcaatatctccggtctggtaagcacaac
catgcagaatgaagcccgtcgtctgcgtgccgaacgctggaaagcggaaaatcaggaagg
gatggctgaggtcgcccggtttattgaaatgaacggctcttttgctgacgagaacaggga
ctggtgaaatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttg
tggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggcca
gtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcgggg
atgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcgggg
aagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgt
tctggggaatataaatgtcaggctccgttatacacagccagtctgcaggtcgaccatagt
gactggatatgttgtgttttacagtattatgtagtctgttttttatgcaaaatctaattt
aatatattgatatttatatcattttacgtttctcgttcagctttcttgtacaaagtggtt
gatatccagcacagtggcggccgctcgagtatggtgagcaagggcgaggagctgttcacc
ggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtg
tccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcacc
accggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcag
tgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgccc
gaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgc
gccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgac
ttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaac
gtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccac
aacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggc
gacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaa
gaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatc
actctcggcatggacgagctgtacaaggagggcccgcggttcgaaggtaagcctatccct
aaccctctcctcggtctcgattctacgcgtaccggttagtaatgagtttggaattaattc
tgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccaggcaggcagaagt
atgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctcccca
gcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgccccta
actccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctga
ctaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaag
tagtgaggaggcttttttggaggcctaggcttttgcaaaaagctcccgggagcttgtata
tccattttcggatctgatcagcacgtgttgacaattaatcatcggcatagtatatcggca
tagtataatacgacaaggtgaggaactaaaccatggccaagcctttgtctcaagaagaat
ccaccctcattgaaagagcaacggctacaatcaacagcatccccatctctgaagactaca
gcgtcgccagcgcagctctctctagcgacggccgcatcttcactggtgtcaatgtatatc
attttactgggggaccttgtgcagaactcgtggtgctgggcactgctgctgctgcggcag
ctggcaacctgacttgtatcgtcgcgatcggaaatgagaacaggggcatcttgagcccct
gcggacggtgccgacaggtgcttctcgatctgcatcctgggatcaaagccatagtgaagg
acagtgatggacagccgacggcagttgggattcgtgaattgctgccctctggttatgtgt
gggagggctaagcacaattcgagctcggtacctttaagaccaatgacttacaaggcagct
gtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaa
cgaagacaagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcc
tgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttga
gtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcaga
cccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcag
tatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagct
tataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttca
ctgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctag
ctatcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctc
cgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctg
agctattccagaagtagtgaggaggcttttttggaggcctagggacgtacccaattcgcc
ctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactggga
aaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcg
taatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcga
atgggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgt
gaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttct
cgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccg
atttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtag
tgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaa
tagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttga
tttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaa
atttaacgcgaattttaacaaaatattaacgcttacaatttaggtggcacttttcgggga
aatgtgcgcggaacccctatttgtttatttttctaaatacattcaaatatgtatccgctc
atgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagtatt
caacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgct
cacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggt
tacatcgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgt
tttccaatgatgagcacttttaaagttctgctatgtggcgcggtattatcccgtattgac
gccgggcaagagcaactcggtcgccgcatacactattctcagaatgacttggttgagtac
tcaccagtcacagaaaagcatcttacggatggcatgacagtaagagaattatgcagtgct
gccataaccatgagtgataacactgcggccaacttacttctgacaacgatcggaggaccg
aaggagctaaccgcttttttgcacaacatgggggatcatgtaactcgccttgatcgttgg
gaaccggagctgaatgaagccataccaaacgacgagcgtgacaccacgatgcctgtagca
atggcaacaacgttgcgcaaactattaactggcgaactacttactctagcttcccggcaa
caattaatagactggatggaggcggataaagttgcaggaccacttctgcgctcggccctt
ccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtatc
attgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacgggg
agtcaggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgatt
aagcattggtaactgtcagaccaagtttactcatatatactttagattgatttaaaactt
catttttaatttaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatc
ccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatct
tcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgcta
ccagcggtggtttgtttgccggatcaagagctaccaactctttttccgaaggtaactggc
ttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccac
ttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggct
gctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggat
aaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacg
acctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaa
gggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagg
gagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctga
cttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagc
aacgcggcctttttacggttcctggccttttgctggccttttgctcacatgttctttcct
gcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgct
cgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgccca
atacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacagg
tttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcat
taggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagc
ggataacaatttcacacaggaaacagctatgaccatgattacgccaagcgcgcaattaac
cctcactaaagggaacaaaagctggagctgcaagcttaatgtagtcttatgcaatactct
tgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagc
accgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaac
agacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtat
ttaagtgcctagctcgatacataaacgggtctctctggttagaccagatctgagcctggg
agctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgc
ttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagaccct
tttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagg
gaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagagg
cgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagag
agatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaat
tcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcag
ggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagaca
aatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattata
taatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaagga
agctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggc
cgctgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatata
aatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagag
tggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggag
cagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattat
tgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatc
tgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaa
gatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgca
ccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatc
acacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactcct
taattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagata
aatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattat
tcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatag
tgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccga
ggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagat
ccattcgattagtgaacggatctcgacggtatcgatggtccgaggttctagacgagttta
ctccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgta
tgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtg
atagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttact
ccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataa
gcagagctcgtttagtgaaccgtcagatcgcaccggtc