PortEco logo

phoA:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

phoA

Mnemonic

Phosphate

Synonyms

ECK0378, b0383, JW0374, psiA[1], psiA

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

8.64 minutes 

MG1655: 400971..402386


REL606

NC_012967: 369393..370808


BW2952

NC_012759: 303730..305145


W3110

 

W3110: 400971..402386


DH10B

DH10B: 340302..341717


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

401034

Edman degradation

PMID:6273802[2]
PMID:7022451[3]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

phoA(del) (Keio:JW0374)

deletion

deletion

PMID:16738554[4]

Shigen

CGSC8552[5]

phoA

Deletion

phoA4(Am)

CGSC:4864

amber (UAG) mutation

phoA8(del)

PMID:6450745[6]

CGSC:4917

phoA1

CGSC:6183

phoA64

CGSC:7365

phoA14(Oc)

CGSC:7852

ochre (UAA) mutation

phoA15

CGSC:7856

phoA16(Oc)

CGSC:7862

ochre (UAA) mutation

phoA12

CGSC:7896

phoA6(Oc)

CGSC:8130

ochre (UAA) mutation

phoA7(UGA)

CGSC:8134

opal (UGA) mutation

phoA10

CGSC:8135

phoA5(Am)

CGSC:10564

amber (UAG) mutation

phoA11(Oc)

CGSC:11686

ochre (UAA) mutation

phoA13(Am)

CGSC:14247

amber (UAG) mutation

phoA22

CGSC:14308

phoA37

CGSC:27543

phoA39

CGSC:27544

phoA42

CGSC:27545

phoA43

CGSC:27546

phoA44

CGSC:27547

phoA45

CGSC:27548

phoA47

CGSC:27549

phoA49

CGSC:27550

phoA532(del)

CGSC:72078

phoA748(del)::kan

PMID:16738554[4]

CGSC:102350


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0374

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAAACAAAGCACTATTGCACT

Primer 2:CCTTTCAGCCCCAGAGCGGCTTT

1A10

Kohara Phage

Genobase

PMID:3038334[8]

6A12

Kohara Phage

Genobase

PMID:3038334[8]

zai-3053::Tn10

Linked marker

CAG18091 = CGSC7336[5]

est. P1 cotransduction: 80% [9]
Synonyms:zaj-3053::Tn10 nnnCAG18091 also carries proC9999 (CGSC).

tsx-247::Tn10

Linked marker

CAG12148 = CGSC7337[5]

est. P1 cotransduction: 30% [9]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10727

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10727

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000718

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945041

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0720

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001328

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Kikuchi, Y et al. (1981) The nucleotide sequence of the promoter and the amino-terminal region of alkaline phosphatase structural gene (phoA) of Escherichia coli. Nucleic Acids Res. 9 5671-8 PubMed EcoliWiki page
  3. Bradshaw, RA et al. (1981) Amino acid sequence of Escherichia coli alkaline phosphatase. Proc. Natl. Acad. Sci. U.S.A. 78 3473-7 PubMed EcoliWiki page
  4. 4.0 4.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. Sarthy, A et al. (1981) Deletion map of the Escherichia coli structural gene for alkaline phosphatase, phoA. J. Bacteriol. 145 288-92 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page
  9. 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).

Categories