PortEco logo

purK:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

purK

Mnemonic

Purine

Synonyms

ECK0515, b0522, JW0511, purE2[1], purE2

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

11.87 minutes 

MG1655: 551817..550750


REL606

NC_012967: 524702..523635


BW2952

NC_012759: 453510..454577


W3110

 

W3110: 551817..550750


DH10B

DH10B: 491149..490082


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

550750

Edman degradation

PMID:1534690[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

purK(del) (Keio:JW0511)

deletion

deletion

PMID:16738554[3]

Shigen

CGSC8655[4]

purK::Tn5KAN-2 (FB20194)

Insertion at nt 472 in Minus orientation

PMID:15262929[5]

E. coli Genome Project:FB20194

does not contain pKD46

purK79::Tn10

Insertion at 551,279 bp in MG1655 (NC_000913)

adapted from Nichols et al.[6]

CAG12171 = CGSC7342[4]

Synonyms: purE79::Tn10

purK79::Tn10

PMID:9829956[7] PMID:2540407[8] PMID:3540312[9]

CGSC:7112

purK0

CGSC:25087

purK3200::Tn10kan

PMID:2540407[8] PMID:9829956[7]

CGSC:39381

purK735(del)::kan

PMID:16738554[3]

CGSC:102536


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW0511

Plasmid clone

Shigen

PMID:16769691[10]

Status:Clone OK

Primer 1:GCCAAACAGGTTTGCGTCCTCGG

Primer 2:CCACCGAACTTACTCTGCGCCCA

6E7

Kohara Phage

Genobase

PMID:3038334[11]

gsk-3055::Tn10

Linked marker

CAG12154 = CGSC7341[4]

est. P1 cotransduction: 10% [6]
Synonyms:zbb-30-55::TnlO, zba-3055::Tn10

dsbG601::Tn10

Linked marker

CAG12149 = CGSC7346[4]

est. P1 cotransduction: % [6]
Synonyms:zbd-601::Tn10, zbe-601::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10796

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10796

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000787

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945153

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0789

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0001794

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Meyer, E et al. (1992) Purification and characterization of the purE, purK, and purC gene products: identification of a previously unrecognized energy requirement in the purine biosynthetic pathway. Biochemistry 31 5022-32 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
  5. Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  6. 6.0 6.1 6.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. 7.0 7.1 Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed EcoliWiki page
  8. 8.0 8.1 Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed EcoliWiki page
  9. Wanner, BL (1986) Novel regulatory mutants of the phosphate regulon in Escherichia coli K-12. J. Mol. Biol. 191 39-58 PubMed EcoliWiki page
  10. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  11. Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories