Try the new EcoliHub and let us know what you'd like to see.
recJ:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
recJ |
|---|---|
| Mnemonic |
Recombination |
| Synonyms |
ECK2887, b2892, JW2860[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
65.4 minutes |
MG1655: 3036128..3034395 | ||
|
NC_012967: 2923859..2922126 | ||||
|
W3110 |
|
W3110: 3036762..3035029 | ||
|
DH10B: 3129998..3128265 | ||||
|
NC_012759: 2921543..2923276 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔrecJ (Keio:JW2860) |
deletion |
deletion | |||||
|
At position 1026 in Minus orientation, contains plasmid pKD46. | |||||||
|
At position 1026 in Minus orientation, does not contain plasmid pKD46. | |||||||
|
recJ284::Tn10 |
Insertion of Tn10 (Tetracycline-resistance) at nucleotide 434 relative to GTG start codon |
truncation |
null phenotype, recombination deficient and UV-sensitive in recBC sbcA and recBC sbcBC backgrounds. Highly synergistic for UV-sensitivity, recombination deficiency and partial inviability with recBC. |
CGSC | |||
|
recJ77 |
G to A nucleotide 281 |
G to D amino acid 78 |
similar to recJ284, null | ||||
|
recJ153 recJ154 |
GTG to GTA at start codon |
None |
Reduces expression of recJ gene, can be suppressed by mutations in initiation factor IF3 for translation | ||||
|
recJ153 | |||||||
|
recJ284::Tn10 | |||||||
|
ΔrecJ743::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2860 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACAACAGATACAACTTCG Primer 2:CCAATTGGCCAGATATTGTCGAT | |
|
Linked marker |
est. P1 cotransduction: % [10] | ||
|
Linked marker |
est. P1 cotransduction: 9% [10] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 Glasner JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res 31: 147-51 PubMed EcoliWiki page
- ↑ 5.0 5.1 5.2 Lovett ST & Clark AJ (1984) Genetic analysis of the recJ gene of Escherichia coli K-12. J Bacteriol 157: 190-6 PubMed EcoliWiki page
- ↑ Gillen JR et al. (1981) Genetic analysis of the RecE pathway of genetic recombination in Escherichia coli K-12. J Bacteriol 145: 521-32 PubMed EcoliWiki page
- ↑ Horii Z & Clark AJ (1973) Genetic analysis of the recF pathway to genetic recombination in Escherichia coli K12: isolation and characterization of mutants. J Mol Biol 80: 327-44 PubMed EcoliWiki page
- ↑ Haggerty TJ & Lovett ST (1997) IF3-mediated suppression of a GUA initiation codon mutation in the recJ gene of Escherichia coli. J Bacteriol 179: 6705-13 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 10.0 10.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
