Try the new EcoliHub and let us know what you'd like to see.
rnc:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rnc |
|---|---|
| Mnemonic |
RNase C |
| Synonyms |
ECK2565, b2567, JW2551, ranA[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
58.22 minutes |
MG1655: 2702085..2701405 | ||
|
NC_012967: 2624875..2625555 | ||||
|
W3110 |
|
W3110: 2702719..2702039 | ||
|
DH10B: 2793850..2793170 | ||||
|
NC_012759: 2587210..2587890 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
At position 562 in Plus orientation, contains plasmid pKD46. | |||||||
|
At position 562 in Plus orientation, does not contain plasmid pKD46. | |||||||
|
rncG44D |
G44D |
In rnc-105; loss of activity |
seeded from UniProt:P0A7Y0 | ||||
|
rnc-105 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2551 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAACCCCATCGTAATTAATCG Primer 2:CCTTCCAGCTCCAGTTTTTTCAA | |
|
Linked marker |
est. P1 cotransduction: 20% [5] | ||
|
Linked marker |
est. P1 cotransduction: 76% [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Glasner JD et al. (2003) ASAP, a systematic annotation package for community analysis of genomes. Nucleic Acids Res 31: 147-51 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
