Try the new EcoliHub and let us know what you'd like to see.
rpoZ:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
rpoZ |
|---|---|
| Gene Synonym(s) |
ECK3639, b3649, JW3624, spoS[1] |
| Product Desc. |
RNA polymerase, ω subunit[2][3] RNA polymerase subunit, omega subunit; assembly factor; chaperone-like function stabilizes RNAP[4] |
| Product Synonyms(s) |
RNA polymerase, omega subunit[1], B3649[2][1], SpoS[2][1], RpoZ[2][1] |
| Function from GO | |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): rpoZ-spoT-trmH-recG[2], rpoZ-spoTU-recG |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table.
Notes
Stimulates ppGpp responsiveness of RNAP in vitro. Binds TrxA (Kumar, 2004).[4]
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpoZ |
|---|---|
| Mnemonic |
RNA polymerase |
| Synonyms |
ECK3639, b3649, JW3624, spoS[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
82.34 minutes |
MG1655: 3820129..3820404 | ||
|
NC_012967: 3760463..3760738 | ||||
|
W3110 |
|
W3110: 3818309..3818034 | ||
|
DH10B: 3917707..3917982 | ||||
|
NC_012759: 3708456..3708731 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔrpoZ (Keio:JW3624) |
deletion |
deletion |
PMID:16738554 | ||||
|
ΔrpoZ754::kan |
PMID:16738554 |
| |||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3624 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCACGCGTAACTGTTCAGGA Primer 2:CCACGACGACCTTCAGCAATAGC | |
|
zhg-50::Tn10 |
Linked marker |
est. P1 cotransduction: % [6] | |
|
zic-4901::Tn10 |
Linked marker |
est. P1 cotransduction: 77% [6] | |
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
RpoZ |
|---|---|
| Synonyms |
RNA polymerase, omega subunit[1], B3649[2][1], SpoS[2][1], RpoZ[2][1] |
| Product description |
RNA polymerase, ω subunit[2][3] RNA polymerase subunit, omega subunit; assembly factor; chaperone-like function stabilizes RNAP[4] |
| EC number (for enzymes) | |
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0016779 |
nucleotidyltransferase activity |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0548 |
F |
Seeded from EcoCyc [7] |
complete | |
|
GO:0016740 |
transferase activity |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0808 |
F |
Seeded from EcoCyc [7] |
complete | |
|
GO:0006351 |
transcription, DNA-dependent |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006110 |
P |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0006350 |
transcription |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003716 |
P |
Seeded from EcoCyc [7] |
complete | |
|
GO:0003899 |
DNA-directed RNA polymerase activity |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR003716 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0003677 |
DNA binding |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006110 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005737 |
cytoplasm |
C |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
|
GO:0006457 |
protein folding |
P |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
|
GO:0006461 |
protein complex assembly |
P |
Seeded from EcoCyc 11.1[3]. |
required fields missing | ||||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
dnaK |
PMID:16606699 |
Experiment(s):EBI-1146407 | |
|
Protein |
rpoB |
PMID:16606699 |
Experiment(s):EBI-1146407 | |
|
Protein |
rhsA |
PMID:16606699 |
Experiment(s):EBI-1146407 | |
|
Protein |
nusA |
PMID:15690043 |
Experiment(s):EBI-879161, EBI-893117 | |
|
Protein |
nusG |
PMID:15690043 |
Experiment(s):EBI-879161, EBI-882858 | |
|
Protein |
rplB |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
dnaK |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
rpoA |
PMID:15690043 |
Experiment(s):EBI-879161, EBI-879354, EBI-883271 | |
|
Protein |
rpoB |
PMID:15690043 |
Experiment(s):EBI-879161, EBI-879304, EBI-882858, EBI-883170 | |
|
Protein |
rpoC |
PMID:15690043 |
Experiment(s):EBI-879161, EBI-879261, EBI-882858, EBI-883046 | |
|
Protein |
rpsB |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
rpsG |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
rpsJ |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
rpsM |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
spoT |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
tig |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
rapA |
PMID:15690043 |
Experiment(s):EBI-879161 | |
|
Protein |
rplL |
PMID:15690043 |
Experiment(s):EBI-882858 | |
|
Protein |
rplW |
PMID:15690043 |
Experiment(s):EBI-882858 | |
|
Protein |
rpsT |
PMID:15690043 |
Experiment(s):EBI-882858 | |
|
Protein |
thiG |
PMID:15690043 |
Experiment(s):EBI-882858 | |
|
Protein |
ygjI |
PMID:15690043 |
Experiment(s):EBI-882858 | |
|
Protein |
ykgC |
PMID:15690043 |
Experiment(s):EBI-882858 | |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MARVTVQDAV EKIGNRFDLV LVAARRARQM QVGGKDPLVP EENDKTTVIA LREIEEGLIN NQILDVRERQ EQQEQEAAEL QAVTAIAEGR R |
|---|---|
| Length |
91 |
| Mol. Wt |
10.235 kDa |
| pI |
4.7 (calculated) |
| Extinction coefficient |
0 (calc based on Y, W, and C residues) |
| edit table |
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for rpoZ | |
|
microarray |
Summary of data for rpoZ from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
| edit table |
Notes
Accessions Related to rpoZ Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Shigella flexneri |
RPOZ |
From SHIGELLACYC |
|
E. coli O157 |
RPOZ |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 4.0 4.1 4.2 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 7.0 7.1 7.2 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
- ↑ 8.0 8.1 8.2 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
Categories
