E. coli is indeed the coolest thing on the planet - Carl Zimmer
rpsL:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
rpsL |
|---|---|
| Mnemonic | |
| Synonyms |
ECK3329, b3342, JW3304, asuB, strA[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.84 minutes |
MG1655: 3472574..3472200 | ||
|
W3110 |
|
W3110: 4165864..4166238 | ||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
rpsL136(strR) |
streptomycin resistant | ||||||
|
rpsL31(strR) |
streptomycin resistant | ||||||
|
rpsL8 | |||||||
|
rpsL118(strR) |
streptomycin resistant | ||||||
|
rpsL200(strR) |
streptomycin resistant | ||||||
|
rpsL104 | |||||||
|
rpsL109(strR) |
streptomycin resistant | ||||||
|
rpsL151(strR) |
streptomycin resistant | ||||||
|
rpsL195(strR) |
streptomycin resistant | ||||||
|
rpsL134(strR) |
streptomycin resistant | ||||||
|
rpsL175(strR) |
streptomycin resistant | ||||||
|
rpsL153(strR) |
streptomycin resistant | ||||||
|
rpsL67(strR) |
streptomycin resistant | ||||||
|
rpsL135(strR) |
streptomycin resistant | ||||||
|
rpsL125(strR) |
streptomycin resistant | ||||||
|
rpsL155(strR) |
streptomycin resistant | ||||||
|
rpsL150(strR) |
streptomycin resistant | ||||||
|
rpsL100(strR) |
streptomycin resistant | ||||||
|
rpsL181(strR) |
streptomycin resistant | ||||||
|
rpsL178(strR) |
streptomycin resistant | ||||||
|
rpsL172(strR) |
streptomycin resistant | ||||||
|
rpsL173(strR) |
streptomycin resistant | ||||||
|
rpsL223(strR) |
streptomycin resistant | ||||||
|
rpsL129(strR) |
streptomycin resistant | ||||||
|
rpsL99(strR) |
streptomycin resistant | ||||||
|
rpsL14 | |||||||
|
rpsL700(strR) |
streptomycin resistant | ||||||
|
rpsL97(strR) |
streptomycin resistant | ||||||
|
rpsL78(strR) |
streptomycin resistant | ||||||
|
rpsL39(StrD) |
streptomycin dependent | ||||||
|
rpsL101(strR) |
streptomycin resistant | ||||||
|
rpsL45(strR) |
streptomycin resistant | ||||||
|
rpsL265(strR) |
streptomycin resistant | ||||||
|
rpsL704(strR) |
streptomycin resistant | ||||||
|
rpsL186(strR) |
streptomycin resistant | ||||||
|
rpsL17 | |||||||
|
rpsL198(strR) |
streptomycin resistant | ||||||
|
rpsL197(strR) |
streptomycin resistant | ||||||
|
rpsL179(strR) |
streptomycin resistant | ||||||
|
rpsL117(strR) |
streptomycin resistant | ||||||
|
rpsL126(strR) |
streptomycin resistant | ||||||
|
rpsL25(strR) |
streptomycin resistant | ||||||
|
rpsL196(strR) |
streptomycin resistant | ||||||
|
rpsL213(strR) |
streptomycin resistant | ||||||
|
rpsL212(strR) |
streptomycin resistant | ||||||
|
rpsL124(strR) |
streptomycin resistant | ||||||
|
rpsL214(strR) |
streptomycin resistant | ||||||
|
rpsL228(strR) |
streptomycin resistant | ||||||
|
rpsL231(strR) |
streptomycin resistant | ||||||
|
rpsL999(strR) |
streptomycin resistant | ||||||
|
rpsL254(strR) |
streptomycin resistant | ||||||
|
rpsL255 | |||||||
|
rpsL261(strR) |
streptomycin resistant | ||||||
|
rpsL35(strR) |
streptomycin resistant | ||||||
|
rpsL146(strR) |
streptomycin resistant | ||||||
|
rpsL110(strR) |
streptomycin resistant | ||||||
|
rpsL145(strR) |
streptomycin resistant | ||||||
|
rpsL257(strR) |
streptomycin resistant | ||||||
|
rpsL284(strR) |
streptomycin resistant | ||||||
|
rpsL283(strR) |
streptomycin resistant | ||||||
|
rpsL180(strR) |
streptomycin resistant | ||||||
|
rpsL182(strR) |
streptomycin resistant | ||||||
|
rpsL204(strR) |
streptomycin resistant | ||||||
|
[rpsL203](strR) |
streptomycin resistant | ||||||
|
rpsL160(strR) |
streptomycin resistant | ||||||
|
rpsL140(strR) |
streptomycin resistant | ||||||
|
rpsL149(strR) |
streptomycin resistant | ||||||
|
rpsL157(strR) |
streptomycin resistant | ||||||
|
rpsL115(strR) |
streptomycin resistant | ||||||
|
rpsL20(strR) |
streptomycin resistant | ||||||
|
rpsL62(strR) |
streptomycin resistant | ||||||
|
rpsL201(strR) |
streptomycin resistant | ||||||
|
rpsL192(strR) |
streptomycin resistant | ||||||
|
rpsL190(strR) |
streptomycin resistant | ||||||
|
rpsL194(strR) |
streptomycin resistant | ||||||
|
rpsL193(strR) |
streptomycin resistant | ||||||
|
rpsL56(strR) |
streptomycin resistant | ||||||
|
rpsL171(strR) |
streptomycin resistant | ||||||
|
rpsL230(strR) |
streptomycin resistant | ||||||
|
rpsL273(strR) |
streptomycin resistant | ||||||
|
rpsL132(strR) |
streptomycin resistant | ||||||
|
rpsL174(strR) |
streptomycin resistant | ||||||
|
rpsL159(strR) |
streptomycin resistant | ||||||
|
rpsL27(strR) |
streptomycin resistant | ||||||
|
rpsL138(strR) |
streptomycin resistant | ||||||
|
rpsL69(strR) |
streptomycin resistant | ||||||
|
rpsL71(strR) |
streptomycin resistant | ||||||
|
rpsL24(strR) |
streptomycin resistant | ||||||
|
rpsL281(strR) |
streptomycin resistant | ||||||
|
rpsL263(strR) |
streptomycin resistant | ||||||
|
rpsL185(strR) |
streptomycin resistant | ||||||
|
rpsL260(strR) |
streptomycin resistant | ||||||
|
rpsL154(strR) |
streptomycin resistant | ||||||
|
rpsL120(strR) |
streptomycin resistant | ||||||
|
rpsL264(strR) |
streptomycin resistant | ||||||
|
rpsL268(strR) |
streptomycin resistant | ||||||
|
rpsL127(strR) |
streptomycin resistant | ||||||
|
rpsL16(strR) |
streptomycin resistant | ||||||
|
rpsL712(strR) |
streptomycin resistant | ||||||
|
rpsL60(strR) |
streptomycin resistant | ||||||
|
rpsL106(strR) |
streptomycin resistant | ||||||
|
rpsL123(strR) |
streptomycin resistant | ||||||
|
rpsL144(strR) |
streptomycin resistant | ||||||
|
rpsL183(strR) |
streptomycin resistant | ||||||
|
rpsL133(strR) |
streptomycin resistant | ||||||
|
rpsL229(strR) |
streptomycin resistant | ||||||
|
rpsL227(strR) |
streptomycin resistant | ||||||
|
rpsL218(strR) |
streptomycin resistant | ||||||
|
rpsL217(strR) |
streptomycin resistant | ||||||
|
rpsL253(strR) |
streptomycin resistant | ||||||
|
rpsL272(strR) |
streptomycin resistant | ||||||
|
rpsL275(strR) |
streptomycin resistant | ||||||
|
rpsL252(strR) |
streptomycin resistant | ||||||
|
rpsL18(strR) |
streptomycin resistant | ||||||
|
rpsL38(strR) |
streptomycin resistant | ||||||
|
rpsL23(strR) |
streptomycin resistant | ||||||
|
rpsL112(strR) |
streptomycin resistant | ||||||
|
rpsL40 | |||||||
|
rpsL30(strR) |
streptomycin resistant | ||||||
|
rpsL33(strR) |
streptomycin resistant | ||||||
|
rpsL114(strR) |
streptomycin resistant | ||||||
|
rpsL12(strR) |
streptomycin resistant | ||||||
|
rpsL143(strR) |
streptomycin resistant | ||||||
|
rpsL102(strR) |
streptomycin resistant | ||||||
|
rpsL119(strR) |
streptomycin resistant | ||||||
|
rpsL137(strR) |
streptomycin resistant | ||||||
|
rpsL139(strR) |
streptomycin resistant | ||||||
|
rpsL256(strR) |
streptomycin resistant | ||||||
|
rpsL184(strR) |
streptomycin resistant | ||||||
|
rpsL176(strR) |
streptomycin resistant | ||||||
|
rpsL199(strR) |
streptomycin resistant | ||||||
|
rpsL262(strR) |
streptomycin resistant | ||||||
|
rpsL58(strR) |
streptomycin resistant | ||||||
|
rpsL90(strR) |
streptomycin resistant | ||||||
|
rpsL219(strR) |
streptomycin resistant | ||||||
|
rpsL61(strR) |
streptomycin resistant | ||||||
|
rpsL91(strR) |
streptomycin resistant | ||||||
|
rpsL93(strR) |
streptomycin resistant | ||||||
|
rpsL94(strR) |
streptomycin resistant | ||||||
|
rpsL95(strR) |
streptomycin resistant | ||||||
|
rpsL128(strR) |
streptomycin resistant | ||||||
|
rpsL215(strR) |
streptomycin resistant | ||||||
|
rpsL221(strR) |
streptomycin resistant | ||||||
|
rpsL222(strR) |
streptomycin resistant | ||||||
|
rpsL224(strR) |
streptomycin resistant | ||||||
|
rpsL226(strR) |
streptomycin resistant | ||||||
|
rpsL290(strR) |
streptomycin resistant | ||||||
|
rpsL267(strR) |
streptomycin resistant | ||||||
|
rpsL321 | |||||||
|
rpsL286 | |||||||
|
rpsL9 |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3304 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCAACAGTTAACCAGCTGGT Primer 2:CCAGCCTTAGGACGCTTCACGCC | |
|
Linked marker |
est. P1 cotransduction: 15% [6] Synonyms:zhb-3082::Tn10, zhd-3082::Tn10 | ||
|
Linked marker |
est. P1 cotransduction: 30% [6] Synonyms:zhe-3084::Tn10
| ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Chakrabarti S & Gorini L (1975) Growth of bacteriophages MS2 and T7 on streptomycin-resistant mutants of Escherichia coli. J Bacteriol 121: 670-4 PubMed EcoliWiki page
- ↑ Chakrabarti SL & Gorini L (1975) A link between streptomycin and rifampicin mutation. Proc Natl Acad Sci U S A 72: 2084-7 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
