Try the new EcoliHub and let us know what you'd like to see.
rpsL:On One Page
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Quickview | | Gene | | Product(s) | | Expression| | Evolution | | References | |
Quickview
See Help:Quickview for help with entering information in the Quickview table.
| Standard Name |
rpsL |
|---|---|
| Gene Synonym(s) |
ECK3329, b3342, JW3304, asuB, strA[1] |
| Product Desc. |
30S ribosomal subunit protein S12[2][3]; Component of 30S ribosomal subunit[2][3]; ribosome[2][3] 30S ribosomal subunit protein S12; RNA chaperone[4] |
| Product Synonyms(s) |
30S ribosomal subunit protein S12[1], B3342[2][1], StrA[2][1], AsuB[2][1], RpsL[2][1] |
| Function from GO |
Biological Process
Molecular Function Cellular Component |
| Knock-Out Phenotype | |
| Regulation/Expression |
transcription unit(s): rpsLG-fusA-tufA[2] |
| Regulation/Activity | |
| Quick Links | |
| edit table |
See Help:Quickview for help with entering information in the Quickview table. RpsL is a ribosomal gene that encodes the highly conserved rps12 protein of the ribosomal accuracy center in the Escherichia coli. Numerous mutations in the rpsL gene generate resistance to, and in some instances dependence on, high levels of streptomycin. [5]
References
- ↑ 1.0 1.1 1.2 1.3 1.4 1.5 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 3.2 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ Toivonen JM et al. (1999) Modelling in Escherichia coli of mutations in mitoribosomal protein S12: novel mutant phenotypes of rpsL. Mol Microbiol 31: 1735-46 PubMed EcoliWiki page
</noinclude>
Mutations in regions 41-45 (except when lys42 is replaced with arg), 87-93 and 53 result in streptomycin resistance. A point mutation at 262 from A to G sustains protein synthesis in late stationary phase and increases the stability of the 70S complex in low magnesium concentrations.[1]
Gene
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
rpsL |
|---|---|
| Mnemonic |
Ribosomal protein, small |
| Synonyms |
ECK3329, b3342, JW3304, asuB, strA[2] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
74.84 minutes |
MG1655: 3472574..3472200 | ||
|
NC_012967: 3402457..3402083 | ||||
|
W3110 |
|
W3110: 4165864..4166238 | ||
|
NC_012759: 3359357..3359731 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Strain DH10B |
K43R |
Nonsynonomous mutation |
PMID:18245285 |
This is a SNP in E. coli K-12 Strain DH10B | |||
|
rpsLK43R |
K43R |
(confers streptomycin resistance but not hyperaccurate translation) |
Strain variation; seeded from UniProt:P0A7S3 | ||||
|
rpsLL57H |
L57H |
Protein is not incorporated into ribosomes |
seeded from UniProt:P0A7S3 | ||||
|
rpsLK88Q |
K88Q |
Confers low-level resistance to streptomycin and a 15% decrease in the translational elongation rate |
seeded from UniProt:P0A7S3 | ||||
|
rpsL136(strR) |
streptomycin resistant | ||||||
|
rpsL31(strR) |
streptomycin resistant | ||||||
|
rpsL8 | |||||||
|
rpsL118(strR) |
streptomycin resistant | ||||||
|
rpsL200(strR) |
streptomycin resistant | ||||||
|
rpsL104 | |||||||
|
rpsL109(strR) |
streptomycin resistant | ||||||
|
rpsL151(strR) |
streptomycin resistant | ||||||
|
rpsL195(strR) |
streptomycin resistant | ||||||
|
rpsL134(strR) |
streptomycin resistant | ||||||
|
rpsL175(strR) |
streptomycin resistant | ||||||
|
rpsL153(strR) |
streptomycin resistant | ||||||
|
rpsL67(strR) |
streptomycin resistant | ||||||
|
rpsL135(strR) |
streptomycin resistant | ||||||
|
rpsL125(strR) |
streptomycin resistant | ||||||
|
rpsL155(strR) |
streptomycin resistant | ||||||
|
rpsL150(strR) |
streptomycin resistant | ||||||
|
rpsL100(strR) |
streptomycin resistant | ||||||
|
rpsL181(strR) |
streptomycin resistant | ||||||
|
rpsL178(strR) |
streptomycin resistant | ||||||
|
rpsL172(strR) |
streptomycin resistant | ||||||
|
rpsL173(strR) |
streptomycin resistant | ||||||
|
rpsL223(strR) |
streptomycin resistant | ||||||
|
rpsL129(strR) |
streptomycin resistant | ||||||
|
rpsL99(strR) |
streptomycin resistant | ||||||
|
rpsL14 | |||||||
|
rpsL700(strR) |
streptomycin resistant | ||||||
|
rpsL97(strR) |
streptomycin resistant | ||||||
|
rpsL78(strR) |
streptomycin resistant | ||||||
|
rpsL39(StrD) |
streptomycin dependent | ||||||
|
rpsL101(strR) |
streptomycin resistant | ||||||
|
rpsL45(strR) |
streptomycin resistant | ||||||
|
rpsL265(strR) |
streptomycin resistant | ||||||
|
rpsL704(strR) |
streptomycin resistant | ||||||
|
rpsL186(strR) |
streptomycin resistant | ||||||
|
rpsL17 | |||||||
|
rpsL198(strR) |
streptomycin resistant | ||||||
|
rpsL197(strR) |
streptomycin resistant | ||||||
|
rpsL179(strR) |
streptomycin resistant | ||||||
|
rpsL117(strR) |
streptomycin resistant | ||||||
|
rpsL126(strR) |
streptomycin resistant | ||||||
|
rpsL25(strR) |
streptomycin resistant | ||||||
|
rpsL196(strR) |
streptomycin resistant | ||||||
|
rpsL213(strR) |
streptomycin resistant | ||||||
|
rpsL212(strR) |
streptomycin resistant |
PMID:1089639 PMID:1094452 | |||||
|
rpsL124(strR) |
streptomycin resistant | ||||||
|
rpsL214(strR) |
streptomycin resistant | ||||||
|
rpsL228(strR) |
streptomycin resistant | ||||||
|
rpsL231(strR) |
streptomycin resistant | ||||||
|
rpsL999(strR) |
streptomycin resistant | ||||||
|
rpsL254(strR) |
streptomycin resistant | ||||||
|
rpsL255 | |||||||
|
rpsL261(strR) |
streptomycin resistant | ||||||
|
rpsL35(strR) |
streptomycin resistant | ||||||
|
rpsL146(strR) |
streptomycin resistant | ||||||
|
rpsL110(strR) |
streptomycin resistant | ||||||
|
rpsL145(strR) |
streptomycin resistant | ||||||
|
rpsL257(strR) |
streptomycin resistant | ||||||
|
rpsL284(strR) |
streptomycin resistant | ||||||
|
rpsL283(strR) |
streptomycin resistant | ||||||
|
rpsL180(strR) |
streptomycin resistant | ||||||
|
rpsL182(strR) |
streptomycin resistant | ||||||
|
rpsL204(strR) |
streptomycin resistant | ||||||
|
[rpsL203](strR) |
streptomycin resistant | ||||||
|
rpsL160(strR) |
streptomycin resistant | ||||||
|
rpsL140(strR) |
streptomycin resistant | ||||||
|
rpsL149(strR) |
streptomycin resistant | ||||||
|
rpsL157(strR) |
streptomycin resistant | ||||||
|
rpsL115(strR) |
streptomycin resistant | ||||||
|
rpsL20(strR) |
streptomycin resistant | ||||||
|
rpsL62(strR) |
streptomycin resistant | ||||||
|
rpsL201(strR) |
streptomycin resistant | ||||||
|
rpsL192(strR) |
streptomycin resistant | ||||||
|
rpsL190(strR) |
streptomycin resistant | ||||||
|
rpsL194(strR) |
streptomycin resistant | ||||||
|
rpsL193(strR) |
streptomycin resistant | ||||||
|
rpsL56(strR) |
streptomycin resistant | ||||||
|
rpsL171(strR) |
streptomycin resistant | ||||||
|
rpsL230(strR) |
streptomycin resistant | ||||||
|
rpsL273(strR) |
streptomycin resistant | ||||||
|
rpsL132(strR) |
streptomycin resistant | ||||||
|
rpsL174(strR) |
streptomycin resistant | ||||||
|
rpsL159(strR) |
streptomycin resistant | ||||||
|
rpsL27(strR) |
streptomycin resistant | ||||||
|
rpsL138(strR) |
streptomycin resistant | ||||||
|
rpsL69(strR) |
streptomycin resistant | ||||||
|
rpsL71(strR) |
streptomycin resistant | ||||||
|
rpsL24(strR) |
streptomycin resistant | ||||||
|
rpsL281(strR) |
streptomycin resistant | ||||||
|
rpsL263(strR) |
streptomycin resistant | ||||||
|
rpsL185(strR) |
streptomycin resistant | ||||||
|
rpsL260(strR) |
streptomycin resistant | ||||||
|
rpsL154(strR) |
streptomycin resistant | ||||||
|
rpsL120(strR) |
streptomycin resistant | ||||||
|
rpsL264(strR) |
streptomycin resistant | ||||||
|
rpsL268(strR) |
streptomycin resistant | ||||||
|
rpsL127(strR) |
streptomycin resistant | ||||||
|
rpsL16(strR) |
streptomycin resistant | ||||||
|
rpsL712(strR) |
streptomycin resistant | ||||||
|
rpsL60(strR) |
streptomycin resistant | ||||||
|
rpsL106(strR) |
streptomycin resistant | ||||||
|
rpsL123(strR) |
streptomycin resistant | ||||||
|
rpsL144(strR) |
streptomycin resistant | ||||||
|
rpsL183(strR) |
streptomycin resistant | ||||||
|
rpsL133(strR) |
streptomycin resistant | ||||||
|
rpsL229(strR) |
streptomycin resistant | ||||||
|
rpsL227(strR) |
streptomycin resistant | ||||||
|
rpsL218(strR) |
streptomycin resistant | ||||||
|
rpsL217(strR) |
streptomycin resistant | ||||||
|
rpsL253(strR) |
streptomycin resistant | ||||||
|
rpsL272(strR) |
streptomycin resistant | ||||||
|
rpsL275(strR) |
streptomycin resistant | ||||||
|
rpsL252(strR) |
streptomycin resistant | ||||||
|
rpsL18(strR) |
streptomycin resistant | ||||||
|
rpsL38(strR) |
streptomycin resistant | ||||||
|
rpsL23(strR) |
streptomycin resistant | ||||||
|
rpsL112(strR) |
streptomycin resistant | ||||||
|
rpsL40 | |||||||
|
rpsL30(strR) |
streptomycin resistant | ||||||
|
rpsL33(strR) |
streptomycin resistant | ||||||
|
rpsL114(strR) |
streptomycin resistant | ||||||
|
rpsL12(strR) |
streptomycin resistant | ||||||
|
rpsL143(strR) |
streptomycin resistant | ||||||
|
rpsL102(strR) |
streptomycin resistant | ||||||
|
rpsL119(strR) |
streptomycin resistant | ||||||
|
rpsL137(strR) |
streptomycin resistant | ||||||
|
rpsL139(strR) |
streptomycin resistant | ||||||
|
rpsL256(strR) |
streptomycin resistant | ||||||
|
rpsL184(strR) |
streptomycin resistant | ||||||
|
rpsL176(strR) |
streptomycin resistant | ||||||
|
rpsL199(strR) |
streptomycin resistant | ||||||
|
rpsL262(strR) |
streptomycin resistant | ||||||
|
rpsL58(strR) |
streptomycin resistant | ||||||
|
rpsL90(strR) |
streptomycin resistant | ||||||
|
rpsL219(strR) |
streptomycin resistant | ||||||
|
rpsL61(strR) |
streptomycin resistant | ||||||
|
rpsL91(strR) |
streptomycin resistant | ||||||
|
rpsL93(strR) |
streptomycin resistant | ||||||
|
rpsL94(strR) |
streptomycin resistant | ||||||
|
rpsL95(strR) |
streptomycin resistant | ||||||
|
rpsL128(strR) |
streptomycin resistant | ||||||
|
rpsL215(strR) |
streptomycin resistant | ||||||
|
rpsL221(strR) |
streptomycin resistant | ||||||
|
rpsL222(strR) |
streptomycin resistant | ||||||
|
rpsL224(strR) |
streptomycin resistant | ||||||
|
rpsL226(strR) |
streptomycin resistant | ||||||
|
rpsL290(strR) |
streptomycin resistant | ||||||
|
rpsL267(strR) |
streptomycin resistant | ||||||
|
rpsL321 | |||||||
|
rpsL286 | |||||||
|
rpsL9 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3304 |
Plasmid clone |
PMID:16769691 Status:Clone OK Primer 1:GCCGCAACAGTTAACCAGCTGGT Primer 2:CCAGCCTTAGGACGCTTCACGCC | |
|
Linked marker |
est. P1 cotransduction: 15% [4] | ||
|
Linked marker |
est. P1 cotransduction: 30% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Product(s)
Nomenclature
See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.
| Standard name |
RpsL |
|---|---|
| Synonyms |
30S ribosomal subunit protein S12[2], B3342[5][2], StrA[5][2], AsuB[5][2], RpsL[5][2] |
| Product description |
30S ribosomal subunit protein S12[5][6]; Component of 30S ribosomal subunit[5][6]; ribosome[5][6] 30S ribosomal subunit protein S12; RNA chaperone[1] |
| EC number (for enzymes) |
|
| edit table |
Notes
Function
Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.
| Qualifier | GO ID | GO term name | Reference(s) | Evidence Code | with/from | Aspect | Notes | Status |
|---|---|---|---|---|---|---|---|---|
|
GO:0046677 |
response to antibiotic |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0046 |
P |
Seeded from EcoCyc [7] |
complete | |
|
GO:0030529 |
ribonucleoprotein complex |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0687 |
C |
Seeded from EcoCyc [7] |
complete | |
|
GO:0019843 |
rRNA binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0699 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0015935 |
small ribosomal subunit |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005679 |
C |
Seeded from EcoCyc [7] |
complete | |
|
GO:0006412 |
translation |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005679 |
P |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0005840 |
ribosome |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR006032 |
C |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0003735 |
structural constituent of ribosome |
GO_REF:0000002 |
IEA: Inferred from Electronic Annotation |
InterPro:IPR005679 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0003723 |
RNA binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0694 |
F |
Seeded from EcoCyc 12.5 [8] |
complete | |
|
GO:0000049 |
tRNA binding |
GO_REF:0000004 |
IEA: Inferred from Electronic Annotation |
SP_KW:KW-0820 |
F |
Seeded from EcoCyc [7] |
complete | |
|
GO:0022626 |
cytosolic ribosome |
C |
Seeded from EcoCyc 11.1[6]. |
required field missing | ||||
|
GO:0000372 |
Group I intron splicing |
PMID:7958841 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc [7] |
complete | ||
|
GO:0033120 |
positive regulation of RNA splicing |
PMID:7958841 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc [7] |
complete | ||
|
GO:0034336 |
misfolded RNA binding |
PMID:7958841 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc [7] |
complete | ||
|
GO:0034337 |
RNA folding |
PMID:7958841 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc [7] |
complete | ||
|
GO:0006412 |
translation |
PMID:4579428 |
IDA: Inferred from Direct Assay |
P |
Seeded from EcoCyc 11.1[6]. Data in Table IV. |
complete | ||
|
GO:0003735 |
structural constituent of ribosome |
PMID:4587209 |
IDA: Inferred from Direct Assay |
F |
Seeded from EcoCyc 11.1[6]. |
complete | ||
|
GO:0005737 |
cytoplasm |
C |
Seeded from EcoCyc 11.1[6]. |
required fields missing | ||||
|
GO:0022627 |
cytosolic small ribosomal subunit |
PMID:4587209 |
IDA: Inferred from Direct Assay |
C |
complete | |||
| edit table |
Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
|
Protein |
Subunits of 30S ribosomal subunit |
could be indirect | ||
|
Protein |
ycgL |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
hns |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
yedI |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rplO |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rplA |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rpsI |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rpsD |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
cspI |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
rplB |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
yedN |
PMID:16606699 |
Experiment(s):EBI-1145610 | |
|
Protein |
Subunits of ribosome |
could be indirect |
| |
| edit table |
Notes
Localization
See Help:Product_localization for how to add or edit information in this section of EcoliWiki.
| Compartment | Description | Evidence | Source | Notes |
|---|---|---|---|---|
|
cytoplasm |
From EcoCyc[6] |
| ||
| edit table |
Notes
Structure and Physical Properties
Physical Properties
See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.
| Sequence |
MATVNQLVRK PRARKVAKSN VPALEACPQK RGVCTRVYTT TPKKPNSALR KVCRVRLTNG FEVTSYIGGE GHNLQEHSVI LIRGGRVKDL PGVRYHTVRG ALDCSGVKDR KQARSKYGVK RPKA |
|---|---|
| Length |
124 |
| Mol. Wt |
13.736 kDa |
| pI |
11.3 (calculated) |
| Extinction coefficient |
5,960 - 6,460 (calc based on 4 Y, W, and 4 C residues) |
| edit table |
|
See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.
|
|
|
Structure
|
Structure figures
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Resource type | Source | Notes/Reference |
|---|---|---|
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Expression
Overview
This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Cellular Levels
| Molecule | Organism or Strain | Cellular level | Units | Medium | Temperature °C | Other (e.g. anaerobic) | Growth rate | Assay used | Notes | Reference(s) |
|---|---|---|---|---|---|---|---|---|---|---|
| edit table |
Notes
Transcription and Transcriptional Regulation
|
See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.
| Figure courtesy of RegulonDB |
Notes
This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Translation and Regulation of Translation
This picture shows the sequence around the N-terminus.
Notes
This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.
Turnover and Regulation of Turnover
Notes
This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.
Experimental
Mutations Affecting Expression
See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.
| Allele Name | Mutation | Phenotype | Reference |
|---|---|---|---|
| edit table |
Expression Studies
See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.
| Type | Reference | Notes |
|---|---|---|
|
microarray |
NCBI GEO profiles for rpsL | |
|
microarray |
Summary of data for rpsL from multiple microarray studies | |
| edit table |
Expression Resources
See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.
| Resource Name | Resource Type | Description | Source | Notes |
|---|---|---|---|---|
|
GFP Fusion |
Intergenic region (3472090..3472326) fused to gfpmut2. |
GFP fusion described in Zaslaver, et al. | ||
| edit table |
Notes
Accessions Related to rpsL Expression
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
Evolution
Homologs in Other Organisms
See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.
| Organism | Homologs (Statistics) | Comments |
|---|---|---|
|
Anopheles gambiae |
|
From Inparanoid:20070104 |
|
Apis mellifera |
|
From Inparanoid:20070104 |
|
Arabidopsis thaliana |
|
From Inparanoid:20070104 |
|
Bos taurus |
|
From Inparanoid:20070104 |
|
Caenorhabditis briggsae |
|
From Inparanoid:20070104 |
|
Caenorhabditis elegans |
|
From Inparanoid:20070104 |
|
Canis familiaris |
|
From Inparanoid:20070104 |
|
Dictyostelium discoideum |
|
From Inparanoid:20070104 |
|
Drosophila melanogaster |
|
From Inparanoid:20070104 |
|
Drosophila pseudoobscura |
|
From Inparanoid:20070104 |
|
Homo sapiens |
|
From Inparanoid:20070104 |
|
Macaca mulatta |
|
From Inparanoid:20070104 |
|
Monodelphis domestica |
|
From Inparanoid:20070104 |
|
Mus musculus |
|
From Inparanoid:20070104 |
|
Oryza gramene |
|
From Inparanoid:20070104 |
|
Pan troglodytes |
|
From Inparanoid:20070104 |
|
Rattus norvegicus |
|
From Inparanoid:20070104 |
|
Saccharomyces cerevisiae |
|
From Inparanoid:20070104 |
|
Schizosaccharomyces pombe |
|
From Inparanoid:20070104 |
|
Takifugu rubripes |
|
From Inparanoid:20070104 |
|
Tetraodon nigroviridis |
|
From Inparanoid:20070104 |
|
Xenopus tropicalis |
|
From Inparanoid:20070104 |
|
Shigella flexneri |
RPSL |
From SHIGELLACYC |
|
E. coli O157 |
RPSL |
From ECOO157CYC |
| edit table |
Do-It-Yourself Web Tools
Notes
Families
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
- ↑ 2.0 2.1 2.2 2.3 2.4 2.5 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ 5.0 5.1 5.2 5.3 5.4 5.5 5.6 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 6.0 6.1 6.2 6.3 6.4 6.5 6.6 6.7 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 7.0 7.1 7.2 7.3 7.4 7.5 7.6 7.7 EcoCyc (release 13.0; 2009) Keseler, IM et al. (2009) Nucleic Acids Res. 37(Database issue):D464-70
- ↑ 8.0 8.1 8.2 8.3 8.4 EcoCyc (release 12.5; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ Zaslaver A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat Methods 3: 623-8 PubMed EcoliWiki page
Categories
