PortEco logo

srlD:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

srlD

Mnemonic

Sorbitol

Synonyms

ECK2700, b2705, JW2674, gutD[1], gutD

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

60.9 minutes, 60.9 minutes 

MG1655: 2825759..2826538


REL606

NC_012967: 2722596..2723375


BW2952

NC_012759: 2711571..2712350


W3110

 

W3110: 2826393..2827172


DH10B

DH10B: 2918301..2919080


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2825759

Edman degradation

PMID:6384188[2]


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

srlD(del) (Keio:JW2674)

deletion

deletion

PMID:16738554[3]

Shigen
CGSC10109[4]

srlD3131::Tn10

Insertion at 2,826,374 bp in MG1655 (NC_000913)

adapted from Nichols et al.[5]

CAG18642 = CGSC7423[4]

Synonyms: zfh-3131::Tn10, zfi-3131::Tn10

srlD300::Tn10

PMID:6249792[6]

CGSC:6890

srlD50

CGSC:7422

srlD3131::Tn10

PMID:2540407[7] PMID:9829956[8]

CGSC:40095

srlD780(del)::kan

PMID:16738554[3]

CGSC:103014


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2674

Plasmid clone

Shigen

PMID:16769691[9]

Status:Clone OK

Primer 1:GCCAATCAGGTTGCCGTTGTCAT

Primer 2:CCGAACATCACCTGACCGCCGGT

23B7

Kohara Phage

Genobase

PMID:3038334[10]

9G10

Kohara Phage

Genobase

PMID:3038334[10]

pheA18::Tn10

Linked marker

CAG12158 = CGSC7421[4]

est. P1 cotransduction: % [5]

cysI95::Tn10

Linked marker

CAG12173 = CGSC7425[4]

est. P1 cotransduction: 4% [5]
Synonyms:cysC95::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG10971

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG10971

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120000960

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948937

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB0964

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0008896

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. Novotny, MJ et al. (1984) Purification and properties of D-mannitol-1-phosphate dehydrogenase and D-glucitol-6-phosphate dehydrogenase from Escherichia coli. J. Bacteriol. 159 986-90 PubMed EcoliWiki page
  3. 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  4. 4.0 4.1 4.2 4.3 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 5.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  6. Csonka, LN & Clark, AJ (1980) Construction of an Hfr strain useful for transferring recA mutations between Escherichia coli strains. J. Bacteriol. 143 529-30 PubMed EcoliWiki page
  7. Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed EcoliWiki page
  8. Nichols, BP et al. (1998) Sequence analysis of Tn10 insertion sites in a collection of Escherichia coli strains used for genetic mapping and strain construction. J. Bacteriol. 180 6408-11 PubMed EcoliWiki page
  9. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  10. 10.0 10.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories