PortEco logo

syd:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

syd

Gene Synonym(s)

ECK2788, b2793, JW2764, ydr[1], ydr

Product Desc.

predicted protein[2][3]

Interacts with secY[4]

Product Synonyms(s)

predicted protein[1], B2793[2][1], Ydr[2][1], Syd[2][1] , ECK2788, JW2764, ydr, b2793

Function from GO

Molecular Function

Knock-Out Phenotype
Regulation/Expression

transcription unit(s): syd[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]





Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

syd

Mnemonic

secY-d1 suppression

Synonyms

ECK2788, b2793, JW2764, ydr[1], ydr

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

62.99 minutes 

MG1655: 2923302..2922757


REL606

NC_012967: 2814209..2813664


BW2952

NC_012759: 2809905..2810450


W3110

 

W3110: 2923936..2923391


DH10B

DH10B: 3017180..3016635


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

2922757

Edman degradation

PMID:7890670


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δsyd (Keio:JW2764)

deletion

deletion

PMID:16738554

Shigen
CGSC10167[5]

Δsyd-720::kan

PMID:16738554

CGSC:103076


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW2764

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGACGATTTGACCGCACAAGC

Primer 2:CCaAGAAGAGGCTTAAGTTGATT

10B5

Kohara Phage

Genobase

PMID:3038334

8C5

Kohara Phage

Genobase

PMID:3038334

cysI95::Tn10

Linked marker

CAG12173 = CGSC7425[5]

est. P1 cotransduction: 22% [6]
Synonyms:cysC95::Tn10

fucP3072::Tn10

Linked marker

CAG12079 = CGSC7427[5]

est. P1 cotransduction: 72% [6]
Synonyms:fuc-3072::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7451

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12959

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004014

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:947271

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2792

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009154

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

Syd

Synonyms

predicted protein[1], B2793[2][1], Ydr[2][1], Syd[2][1] , ECK2788, JW2764, ydr, b2793

Product description

predicted protein[2][3]

Interacts with secY[4]

EC number (for enzymes)


Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0005515

protein binding

PMID:19139097

IPI: Inferred from Physical Interaction

UniProtKB:P0AGA2

F

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

yccS

PMID:19402753

LCMS(ID Probability):99.4

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MDDLTAQALK DFTARYCDAW HEEHKSWPLS EELYGVPSPC IISTTEDAVY WQPQPFTGEQ
NVNAVERAFD IVIQPTIHTF YTTQFAGDMH AQFGDIKLTL LQTWSEDDFR RVQENLIGHL
VTQKRLKLPP TLFIATLEEE LEVISVCNLS GEVCKETLGT RKRTHLASNL AEFLNQLKPL L
Length

181

Mol. Wt

20.708 kDa

pI

4.8 (calculated)

Extinction coefficient

27,960 - 28,460 (calc based on 4 Y, 4 W, and 4 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

Domain

8..181

PF07348 Syd protein

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16130700

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:947271

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009154

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P0A8U0

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:G7451

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12959

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:947271

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004014

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2792

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

Ecoli K-12

11.303+/-0.085

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

Single Molecule Fluorescence

PMID:20671182

mRNA

Ecoli K-12

0.039449541

Molecules/cell

  • Medium:
  • Temperature (°C):
  • Doubling time (min): Growth Rate(min): *
  • Growth phase: other: *

by RNA_Seq

PMID:20671182

Protein

E. coli K-12 MG1655

982

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

268

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

527

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

syd

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b2793 (EcoliWiki Page)

NCBI GEO profiles for syd

microarray

GenExpDB:b2793 (EcoliWiki Page)

Summary of data for syd from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (2923219..2923443) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ14; Well:A1[7]

Notes

Accessions Related to syd Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:G7451

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2792

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2793

EcoGene

EcoGene:EG12959

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004014

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009154

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Shigella flexneri

SYD

From SHIGELLACYC

E. coli O157

SYD

From ECOO157CYC


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Pfam (EcoliWiki Page)

PF07348 Syd protein

EcoCyc

EcoCyc:G7451

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG12959

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120004014

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB2792

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0009154

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.0 1.1 1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  5. 5.0 5.1 5.2 CGSC: The Coli Genetics Stock Center
  6. 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  7. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed EcoliWiki page

Categories

[back to top]