Try the new EcoliHub and let us know what you'd like to see.
thyA:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
thyA |
|---|---|
| Mnemonic |
Thymine |
| Synonyms |
ECK2823, b2827, JW2795[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
63.85 minutes |
MG1655: 2963177..2962383 | ||
|
NC_012967: 2859775..2858981 | ||||
|
W3110 |
|
W3110: 2963811..2963017 | ||
|
DH10B: 3057047..3056253 | ||||
|
NC_012759: 2849531..2850325 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔthyA (Keio:JW2795) |
deletion |
deletion | |||||
|
thyA751 | |||||||
|
thyA25 | |||||||
|
thyA715 | |||||||
|
thyA36 | |||||||
|
thyA6 | |||||||
|
thyA47 | |||||||
|
thyA52 | |||||||
|
thyA12 | |||||||
|
thyA704 | |||||||
|
thyA3 | |||||||
|
thyA81 | |||||||
|
thyA82 | |||||||
|
thyA56 | |||||||
|
thyA117 | |||||||
|
thyA61 | |||||||
|
thyA144 | |||||||
|
thyA54 | |||||||
|
thyA42 | |||||||
|
thyA748::Tn10 | |||||||
|
thyA147 | |||||||
|
thyA148 | |||||||
|
thyA45 | |||||||
|
thyA702 | |||||||
|
thyA55 | |||||||
|
thyA43 | |||||||
|
thyA11 | |||||||
|
thyA24 | |||||||
|
thyA305 | |||||||
|
thyA14 | |||||||
|
thyA33 | |||||||
|
thyA114(Stable)::Mu | |||||||
|
thyA20 | |||||||
|
thyA707 | |||||||
|
thyA111 | |||||||
|
thyA16 | |||||||
|
thyA15 | |||||||
|
thyA705 | |||||||
|
thyA48 | |||||||
|
thyA714 | |||||||
|
thyA95 | |||||||
|
thyA44 | |||||||
|
thyA710 | |||||||
|
thyA0 | |||||||
|
thyA299 | |||||||
|
thyA59 | |||||||
|
thyA746 | |||||||
|
ΔthyA752 | |||||||
|
thyA719 | |||||||
|
thyA755 | |||||||
|
thyA756 | |||||||
|
ΔthyA57 | |||||||
|
thyA758 | |||||||
|
thyA38 | |||||||
|
thyA26 | |||||||
|
thyA41 | |||||||
|
thyA23 | |||||||
|
thyA325 | |||||||
|
thyA46 | |||||||
|
thyA2 | |||||||
|
thyA18 | |||||||
|
thyA34 | |||||||
|
thyA10 | |||||||
|
thyA39 | |||||||
|
thyA29 | |||||||
|
thyA27 | |||||||
|
thyA53 | |||||||
|
thyA28 | |||||||
|
thyA30 | |||||||
|
thyA31 | |||||||
|
thyA49 | |||||||
|
thyA709 | |||||||
|
thyA17 | |||||||
|
thyA51 | |||||||
|
thyA321 | |||||||
|
thyA58 | |||||||
|
thyA50 | |||||||
|
thyA40 | |||||||
|
thyA333 | |||||||
|
thyA9999(ts)::Mud(Ap,lac) |
temperature sensitive | ||||||
|
thyA149 | |||||||
|
thyA101 | |||||||
|
thyA9 | |||||||
|
thyA326 | |||||||
|
thyA753 | |||||||
|
thyA281 | |||||||
|
thyA294 | |||||||
|
thyA119 | |||||||
|
thyA760 | |||||||
|
thyA749 | |||||||
|
thyA750 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2795 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAACAGTATTTAGAACTGAT Primer 2:CCGATAGCCACCGGCGCTTTAAT | |
|
Linked marker |
est. P1 cotransduction: 67% [5] | ||
|
Linked marker |
est. P1 cotransduction: % [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
