PortEco logo

trg:Gene

From EcoliWiki
Jump to: navigation, search


Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Sequence Features Alleles and Phenotypes Genetic Interactions Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

trg

Mnemonic

Taxis to ribose and galactose

Synonyms

ECK1415, b1421, JW1417[1], JW1417

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

32.12 minutes 

MG1655: 1490494..1492134


REL606

NC_012967: 1462579..1464219


BW2952

NC_012759: 1382553..1384193


W3110

 

W3110: 1494184..1495824


DH10B

DH10B: 1581089..1582729


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

Δtrg (Keio:JW1417)

deletion

deletion

PMID:16738554[2]

Shigen
CGSC9242[3]

trg::Tn5KAN-2 (FB20316)

Insertion at nt 509 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20316

contains pKD46

trg::Tn5KAN-2 (FB20317)

Insertion at nt 509 in Minus orientation

PMID:15262929[4]

E. coli Genome Project:FB20317

does not contain pKD46

trg-2::Tn10

Insertion at 1,491,930 bp in MG1655 (NC_000913)

adapted from Nichols et al.[5]

CAG12026 = CGSC7376[3]

Synonyms:

trg-1::Tn5

CGSC:9685

trg-2::Tn10

PMID:2540407[6]

CGSC:10754

trg-3120::Tn10kan

PMID:2540407[6]

CGSC:39820

Δtrg-782::kan

PMID:16738554[2]

CGSC:103208


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW1417

Plasmid clone

Shigen

PMID:16769691[7]

Status:Clone OK

Primer 1:GCCAATACAACTCCCTCACAGCG

Primer 2:CCaACCGTAGCGAAACTAACTGG

24D6

Kohara Phage

Genobase

PMID:3038334[8]

1A6

Kohara Phage

Genobase

PMID:3038334[8]

zhj-3076::Tn10

Linked marker

CAG18640 = CGSC7453[3]

est. P1 cotransduction: 6% [5]

zdd-235::Tn10

Linked marker

CAG18461 = CGSC7378[3]

est. P1 cotransduction: 13% [5]
Synonyms:zdc-235::Tn10

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG11018

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG11018

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120001007

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:945995

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB1011

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0004744

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



<protect>

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed EcoliWiki page
  3. 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
  4. 4.0 4.1 Kang, Y et al. (2004) Systematic mutagenesis of the Escherichia coli genome. J. Bacteriol. 186 4921-30 PubMed EcoliWiki page
  5. 5.0 5.1 5.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  6. 6.0 6.1 Singer, M et al. (1989) A collection of strains containing genetically linked alternating antibiotic resistance elements for genetic mapping of Escherichia coli. Microbiol. Rev. 53 1-24 PubMed EcoliWiki page
  7. Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed EcoliWiki page
  8. 8.0 8.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed EcoliWiki page

Categories