Try the new EcoliHub and let us know what you'd like to see.
tsx:Gene
From EcoliWiki
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
tsx |
|---|---|
| Mnemonic |
T-six |
| Synonyms |
ECK0405, b0411, JW0401, T6rec, nupA[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
9.28 minutes |
MG1655: 431237..430353 | ||
|
NC_012967: 400435..399662 | ||||
|
W3110 |
|
W3110: 431237..430353 | ||
|
DH10B: 370568..369684 | ||||
|
NC_012759: 333112..333996 | ||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δtsx (Keio:JW0401) |
deletion |
deletion | |||||
|
tsxN276Y |
N276Y |
(in phage resistant mutant) |
Strain variation; seeded from UniProt:P0A927 | ||||
|
tsx-247::Tn10 |
Insertion at 430,667 bp in MG1655 (NC_000913) |
adapted from Nichols et al.[4] |
Synonyms: | ||||
|
tsx-33 | |||||||
|
tsx-29 | |||||||
|
tsx-67 | |||||||
|
tsx-1 | |||||||
|
tsx-70 | |||||||
|
tsx-358 | |||||||
|
tsx-81 | |||||||
|
tsx-76 | |||||||
|
tsx-79 | |||||||
|
tsx-84 | |||||||
|
tsx-95 | |||||||
|
tsx-7 | |||||||
|
tsx-63 | |||||||
|
tsx-78 | |||||||
|
tsx-96 | |||||||
|
tsx-71 | |||||||
|
tsx-64 | |||||||
|
tsx-273 | |||||||
|
tsx-97 | |||||||
|
tsx-0 | |||||||
|
tsx-68 | |||||||
|
tsx-463 | |||||||
|
tsx-352 | |||||||
|
tsx-83 | |||||||
|
tsx-80 | |||||||
|
tsx-82 | |||||||
|
tsx-65 | |||||||
|
tsx-354 | |||||||
|
tsx-356 | |||||||
|
tsx-357 | |||||||
|
tsx-3 | |||||||
|
tsx-61 | |||||||
|
tsx-59 | |||||||
|
tsx-6 | |||||||
|
tsx-274 | |||||||
|
tsx-87 | |||||||
|
tsx-23 | |||||||
|
tsx-25 | |||||||
|
tsx-464 | |||||||
|
tsx-36 | |||||||
|
tsx-57 | |||||||
|
tsx-5 | |||||||
|
tsx-353 | |||||||
|
tsx-462::Tn10 | |||||||
|
tsx-93 | |||||||
|
tsx-466 | |||||||
|
tsx-69 | |||||||
|
tsx-465(Am) |
amber (UAG) mutation | ||||||
|
tsx-72 | |||||||
|
tsx-21 | |||||||
|
tsx-2 | |||||||
|
tsx-85 | |||||||
|
tsx-460 | |||||||
|
tsx-18 | |||||||
|
tsx-17 | |||||||
|
tsx-27 | |||||||
|
tsx-4 | |||||||
|
tsx-58 | |||||||
|
tsx-62 | |||||||
|
tsx-73 | |||||||
|
tsx-459 | |||||||
|
tsx-19 | |||||||
|
tsx-37 | |||||||
|
tsx-77 | |||||||
|
tsx-247::Tn10 | |||||||
|
tsx-3100::Tn10kan | |||||||
|
tsx-35 | |||||||
|
tsx-74 | |||||||
|
tsx-75 | |||||||
|
Δtsx-773::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0401 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAAAAACATTACTGGCAGC Primer 2:CCGAAGTTGTAACCTACTACCAG | |
|
Linked marker |
est. P1 cotransduction: 23% [4] | ||
|
Linked marker |
est. P1 cotransduction: 33% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2: 2006.0008 PubMed EcoliWiki page
- ↑ 3.0 3.1 3.2 3.3 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 4.2 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
- ↑ Kitagawa M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (A Complete Set of E. coli K-12 ORF Archive): Unique Resources for Biological Research. DNA Res 12: 291-9 PubMed EcoliWiki page
