PortEco logo

xylF:On One Page

From EcoliWiki
Jump to: navigation, search
Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Quickview | Gene | Product(s) | Expression| Evolution | References |

Quickview

[back to top]



Standard Name

xylF

Gene Synonym(s)

ECK3555, b3566, JW3538, xylT[1], xylT

Product Desc.

XylF[2][3];

Component of xylose ABC transporter[2][3]

Product Synonyms(s)

D-xylose transporter subunit[1], periplasmic-binding component of ABC superfamily[1], B3566[2][1], XylT[2][1], XylF[2][1] , ECK3555, JW3538, xylT, b3566

Function from GO
Knock-Out Phenotype
Regulation/Expression

transcription unit(s): xylFGHR[2]

Regulation/Activity
Quick Links

porteco.png EcoCyc.gif regulondb.jpg

dnadisplay.png proteindisplay.png   pubmed.jpg   textpresso.jpg  

See Help:Quickview for help with entering information in the Quickview table.

Notes

[back to top]



Gene

[back to top]


Nomenclature

[back to top]


See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Standard name

xylF

Mnemonic

Xylose

Synonyms

ECK3555, b3566, JW3538, xylT[1], xylT

Notes

Location(s) and DNA Sequence

[back to top]


See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

80.38 minutes, 80.38 minutes 

MG1655: 3729154..3730146


REL606

NC_012967: 3661589..3662581


BW2952

NC_012759: 3617480..3618472


W3110

 

W3110: 3909284..3908292


DH10B

DH10B: 3826731..3827723


Notes

Sequence Features

[back to top]


See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Feature Type Strain Genomic Location Evidence Reference Notes

Coding Start (SO:0000323)

MG1655

3729223

Edman degradation

PMID:8581399
PMID:9298646


Notes

Alleles and Phenotypes

[back to top]


See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

ΔxylF (Keio:JW3538)

deletion

deletion

PMID:16738554

Shigen
CGSC10611[4]

xylF::Tn5KAN-I-SceI (FB21290)

Insertion at nt 202 in Plus orientation

PMID:15262929

E. coli Genome Project:FB21290

contains pKD46

xylF::Tn5KAN-I-SceI (FB21291)

Insertion at nt 202 in Plus orientation

PMID:15262929

E. coli Genome Project:FB21291

does not contain pKD46

ΔxylF749::kan

PMID:16738554

CGSC:103428


Notes

Genetic Interactions

[back to top]


Interactor Interaction Allele Score(s) Reference(s) Accessions Notes

Notes

Genetic Resources

[back to top]


See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

JW3538

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAAAATAAAGAACATTCTACT

Primer 2:CCaAGCTCGCTCTCTTTGTGGAA

10C8

Kohara Phage

Genobase

PMID:3038334

6F2

Kohara Phage

Genobase

PMID:3038334

zhg-50::Tn10

Linked marker

CAG18450 = CGSC7450[4]

est. P1 cotransduction: % [5]
Synonyms:zhf-50::Tn10, zhf-5::Tn10

zic-4901::Tn10

Linked marker

CAG18492 = CGSC7457[4]

est. P1 cotransduction: % [5]

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG20252

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG20252

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002448

Escherichia coli str. K-12 substr. MG1655

NCBI (EcoliWiki Page)

GeneID:948090

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4153

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011646

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Product(s)

[back to top]



Nomenclature

See Help:Product_nomenclature for help entering or editing information in this section of EcoliWiki.

Standard name

XylF

Synonyms

D-xylose transporter subunit[1], periplasmic-binding component of ABC superfamily[1], B3566[2][1], XylT[2][1], XylF[2][1] , ECK3555, JW3538, xylT, b3566

Product description

XylF[2][3];

Component of xylose ABC transporter[2][3]

EC number (for enzymes)


Notes

Function

[back to top]


Gene Ontology
See Help:Gene_ontology for help entering or editing GO terms and GO annotations in EcoliWiki.

Qualifier GO ID GO term name Reference Evidence Code with/from Aspect Notes Status

GO:0042597

periplasmic space

GOA:spkw
SP_KW:GO_REF:0000004

IEA: Inferred from Electronic Annotation

SP_KW:KW-0574

C

Seeded from EcoCyc (v14.0)

complete

GO:0042597

periplasmic space

GO_REF:0000023

IEA: Inferred from Electronic Annotation

SP_SL:SL-0200

C

Seeded from EcoCyc (v14.0)

complete

Interactions See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.

Partner Type Partner Notes References Evidence

Protein

Subunits of xylose ABC transporter

could be indirect

Protein

insD1

PMID:16606699

Experiment(s):EBI-1146152

Protein

ddg

PMID:16606699

Experiment(s):EBI-1146152

Notes

Localization

See Help:Product_localization for how to add or edit information in this section of EcoliWiki.

Compartment Description Evidence Reference/Source Notes

Periplasm

PMID:9298646

EchoLocation:xylF

periplasm

From EcoCyc[3]


Notes

Structure and Physical Properties

[back to top]


Physical Properties See Help:Product_physical_properties for help entering or editing information about the physical properties of this gene product.

Name
Sequence

at EcoCyc

MKIKNILLTL CTSLLLTNVA AHAKEVKIGM AIDDLRLERW QKDRDIFVKK AESLGAKVFV
QSANGNEETQ MSQIENMINR GVDVLVIIPY NGQVLSNVVK EAKQEGIKVL AYDRMINDAD
IDFYISFDNE KVGELQAKAL VDIVPQGNYF LMGGSPVDNN AKLFRAGQMK VLKPYVDSGK
IKVVGDQWVD GWLPENALKI MENALTANNN KIDAVVASND ATAGGAIQAL SAQGLSGKVA
ISGQDADLAG IKRIAAGTQT MTVYKPITLL ANTAAEIAVE LGNGQEPKAD TTLNNGLKDV
PSRLLTPIDV NKNNIKDTVI KDGFHKESEL
Length

330

Mol. Wt

35.734 kDa

pI

5.4 (calculated)

Extinction coefficient

25,440 - 25,565 (calc based on 6 Y, 3 W, and 1 C residues)


Domains/Motifs/Modification Sites

See Help:Product_domains_motifs for help entering or editing information in this section of EcoliWiki.

Type Residues Description Notes References

motif

1-23

UniProt Manual:Signal Peptides

UniProt:P37387

Domain

26..278

PF00532 family

PMID:19920124


Structure
See Help:Product_structure for help entering or editing information in this section of EcoliWiki.

Structures

No results found for a best structure.

Models

View models at:

Structure figures

Notes

Gene Product Resources

[back to top]


See Help:Product_resources for help with entering or editing information in this section of EcoliWiki.

Resource type Source Notes/Reference

Notes

Accessions in Other Databases

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

NCBI (Protein) (EcoliWiki Page)

GI:16131437

Escherichia coli str. K-12 substr. MG1655

NCBI (Protein) (EcoliWiki Page)

GeneID:948090

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011646

Escherichia coli str. K-12 substr. MG1655

UniProt (EcoliWiki Page)

UniProtKB/Swiss-Prot:P37387

Escherichia coli str. K-12 substr. MG1655

EcoCyc

EcoCyc:EG20252

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG20252

Escherichia coli str. K-12 substr. MG1655

NCBI (Gene) (EcoliWiki Page)

GeneID:948090

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002448

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4153

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]




Expression

[back to top]



Overview

This is a placeholder for a summary statement on how expression of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.


Cellular Levels

[back to top]


See Help:Cellular levels

Molecule Organism or Strain Value Units Experimental Conditions Assay used Notes Reference(s)

Protein

E. coli K-12 MG1655

1a

molecules/cell/generation

  • Medium: MOPS Complete
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Protein

E. coli K-12 MG1655

6

molecules/cell/generation

  • Medium: MOPS Minimal
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

PMID: 24766808

Protein

E. coli K-12 MG1655

0a

molecules/cell/generation

  • Medium: MOPS Complete without Methionine
  • Temperature (°C): 37
  • Doubling time (min):
  • *Growth phase:
  • OD:
  • other:

Ribosome Profiling

Low confidence in the sequencing data set.

PMID: 24766808

Notes

Transcription and Transcriptional Regulation

[back to top]


See Help:Expression_transcription for help entering or editing information in this section of EcoliWiki.

Transcription unit(s)

xylFGHR

Figure courtesy of RegulonDB

Notes

This is a placeholder for a summary statement about how transcription of this gene is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Translation and Regulation of Translation

[back to top]


This picture shows the sequence around the N-terminus.

Notes

This is a placeholder for a summary statement about how translation of this gene product is regulated. You can help EcoliWiki by becoming a user and writing/editing this statement.

Turnover and Regulation of Turnover

Notes

This is a placeholder for a summary statement about turnover of this gene product. You can help EcoliWiki by becoming a user and writing/editing this statement.

Experimental

[back to top]


Mutations Affecting Expression See Help:Expression_mutations for help entering or editing information in this section of EcoliWiki.

Allele Name Mutation Phenotype Reference


Expression Studies See Help:Expression_studies for help entering or editing information in this section of EcoliWiki.

Type Reference Notes

microarray

GEO Profiles:b3566 (EcoliWiki Page)

NCBI GEO profiles for xylF

microarray

GenExpDB:b3566 (EcoliWiki Page)

Summary of data for xylF from multiple microarray studies


Expression Resources See Help:Expression_resources for help entering or editing information in this section of EcoliWiki.

Resource Name Resource Type Description Source Notes

GFP Fusion

Intergenic region (3728294..3728785) fused to gfpmut2.

OpenBioSystems

GFP fusion described in Zaslaver, et al.
Plate:109-AZ16; Well:H4[6]

Notes

Accessions Related to xylF Expression

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

EcoCyc

EcoCyc:EG20252

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4153

Escherichia coli str. K-12 substr. MG1655

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b3566

EcoGene

EcoGene:EG20252

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002448

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011646

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



Evolution

[back to top]



Homologs in Other Organisms

[back to top]


See Help:Evolution_homologs for help entering or editing information in this section of EcoliWiki.

Organism Homologs (Statistics) Comments

Xenopus tropicalis

  • ENSXETP00000030364 (score: 1.000; bootstrap: 100%)

From Inparanoid:20070104

Shigella flexneri

XYLF

From SHIGELLACYC

E. coli O157

XYLF

From ECOO157CYC


Do-It-Yourself Web Tools

Notes

Families

[back to top]


See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Database Accession Notes

Superfamily (EcoliWiki Page)

SUPERFAMILY:53822

Pfam (EcoliWiki Page)

PF00532 family

EcoCyc

EcoCyc:EG20252

Escherichia coli str. K-12 substr. MG1655

EcoGene

EcoGene:EG20252

Escherichia coli str. K-12 substr. MG1655

RegulonDB

RegulonDB:ECK120002448

Escherichia coli str. K-12 substr. MG1655

EchoBASE

EchoBASE:EB4153

Escherichia coli str. K-12 substr. MG1655

ASAP

ASAP:ABE-0011646

Escherichia coli str. K-12 substr. MG1655

Notes

Links

[back to top]



References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  3. 3.0 3.1 3.2 3.3 3.4 EcoCyc (release 11.1; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
  4. 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
  5. 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).
  6. Zaslaver, A et al. (2006) A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Methods 3 623-8 PubMed EcoliWiki page

Categories

[back to top]